EMAIL THIS PAGE TO A FRIEND

FAM179B

family with sequence similarity 179, member B

244 Gene Product Result for
Synonyms: KIAA0423
UniProtKB ID: Q9Y4F4, Q68D66, Q6PG27
Gene ID:
Mouse(328108) family with sequence similarity 179, member B
Rat(314169) family with sequence similarity 179, member B
chicken(423595) family with sequence similarity 179, member B
dog(490669) family with sequence similarity 179, member B
cow(540222) family with sequence similarity 179, member B
domestic cat(101089018) family with sequence similarity 179, member B
naked mole-rat(101716655) family with sequence similarity 179, member B
domestic guinea pig(100715047) family with sequence similarity 179, member B
sheep(101105443) family with sequence similarity 179, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015091 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015091 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015091 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015091 Rosetta Predictions human pricing
XM_001076246 Rosetta Predictions rat pricing
XM_001076300 Rosetta Predictions rat pricing
XM_234236 Rosetta Predictions rat pricing
XM_001478538 Rosetta Predictions mouse pricing
XM_484151 Rosetta Predictions mouse pricing
XM_896949 Rosetta Predictions mouse pricing
XM_896963 Rosetta Predictions mouse pricing
XM_896976 Rosetta Predictions mouse pricing
XM_896986 Rosetta Predictions mouse pricing
XM_922989 Rosetta Predictions mouse pricing
XM_923034 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234836 predicted 4364
2 SASI_Hs02_00346970 predicted 5440
3 SASI_Hs01_00234837 predicted 750
4 SASI_Hs01_00234838 predicted 4718
5 SASI_Hs01_00234839 predicted 2883
6 SASI_Hs01_00234840 predicted 2411
7 SASI_Hs01_00234841 predicted 2693
8 SASI_Hs01_00234842 predicted 3874
9 SASI_Hs01_00234843 predicted 4708
10 SASI_Hs01_00234844 predicted 815
11 SASI_Hs01_00234845 predicted 3574
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352553 predicted 2135
2 SASI_Rn02_00352554 predicted 1545
3 SASI_Rn02_00352555 predicted 2356
4 SASI_Rn02_00352556 predicted 4739
5 SASI_Rn02_00352557 predicted 4935
6 SASI_Rn02_00352558 predicted 2032
7 SASI_Rn02_00352559 predicted 2744
8 SASI_Rn02_00352560 predicted 5414
9 SASI_Rn02_00352561 predicted 3814
10 SASI_Rn02_00352562 predicted 4793
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076300 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352750 predicted 2130
2 SASI_Rn02_00352751 predicted 1542
3 SASI_Rn02_00352752 predicted 2357
4 SASI_Rn02_00352753 predicted 5035
5 SASI_Rn02_00352754 predicted 3473
6 SASI_Rn02_00352755 predicted 2032
7 SASI_Rn02_00352756 predicted 2744
8 SASI_Rn02_00352757 predicted 5706
9 SASI_Rn02_00352758 predicted 5092
10 SASI_Rn02_00352759 predicted 4670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388346 predicted 2138
2 SASI_Rn02_00388347 predicted 1545
3 SASI_Rn02_00388348 predicted 2354
4 SASI_Rn02_00388349 predicted 5038
5 SASI_Rn02_00388350 predicted 3475
6 SASI_Rn02_00388351 predicted 2035
7 SASI_Rn02_00388352 predicted 2744
8 SASI_Rn02_00388353 predicted 5711
9 SASI_Rn02_00388354 predicted 5090
10 SASI_Rn02_00388355 predicted 4671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00403390 predicted 2134
2 SASI_Mm02_00403391 predicted 3478
3 SASI_Mm02_00403392 predicted 2739
4 SASI_Mm02_00403393 predicted 1229
5 SASI_Mm02_00403394 predicted 5042
6 SASI_Mm02_00403395 predicted 821
7 SASI_Mm02_00403396 predicted 3831
8 SASI_Mm02_00403397 predicted 5173
9 SASI_Mm02_00403398 predicted 5310
10 SASI_Mm02_00403399 predicted 4374
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239460 predicted 5162
2 SASI_Mm01_00239461 predicted 5782
3 SASI_Mm01_00239462 predicted 5718
4 SASI_Mm01_00239463 predicted 4989
5 SASI_Mm01_00239464 predicted 5339
6 SASI_Mm01_00239465 predicted 5047
7 SASI_Mm01_00239466 predicted 4936
8 SASI_Mm01_00239467 predicted 4765
9 SASI_Mm01_00239468 predicted 5172
10 SASI_Mm01_00239469 predicted 5312
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255974 predicted 3401
2 SASI_Mm01_00255975 predicted 2136
3 SASI_Mm01_00255976 predicted 2042
4 SASI_Mm01_00255977 predicted 2746
5 SASI_Mm01_00255978 predicted 1226
6 SASI_Mm01_00255979 predicted 1552
7 SASI_Mm01_00255980 predicted 2366
8 SASI_Mm01_00255981 predicted 833
9 SASI_Mm01_00255982 predicted 1748
10 SASI_Mm01_00255983 predicted 2992
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896963 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235133 predicted 1146
2 SASI_Mm01_00235134 predicted 1209
3 SASI_Mm01_00235135 predicted 989
4 SASI_Mm01_00235136 predicted 1324
5 SASI_Mm01_00235137 predicted 711
6 SASI_Mm01_00235138 predicted 1038
7 SASI_Mm01_00235139 predicted 925
8 SASI_Mm01_00235140 predicted 765
9 SASI_Mm01_00235141 predicted 1180
10 SASI_Mm01_00235142 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204957 predicted 2136
2 SASI_Mm01_00204958 predicted 3484
3 SASI_Mm01_00204959 predicted 2750
4 SASI_Mm01_00204960 predicted 1228
5 SASI_Mm01_00204961 predicted 1545
6 SASI_Mm01_00204962 predicted 2363
7 SASI_Mm01_00204963 predicted 830
8 SASI_Mm01_00204964 predicted 3833
9 SASI_Mm01_00204965 predicted 1741
10 SASI_Mm01_00204966 predicted 4382
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220355 predicted 4686
2 SASI_Mm02_00429794 predicted 5262
3 SASI_Mm01_00220357 predicted 4738
4 SASI_Mm02_00429795 predicted 4673
5 SASI_Mm02_00429796 predicted 4696
6 SASI_Mm02_00429797 predicted 4677
7 SASI_Mm02_00429798 predicted 4742
8 SASI_Mm02_00429799 predicted 4745
9 SASI_Mm02_00429800 predicted 4751
10 SASI_Mm02_00429801 predicted 5245
11 SASI_Mm01_00220353 predicted 4865
12 SASI_Mm01_00220354 predicted 4920
13 SASI_Mm01_00220356 predicted 5040
14 SASI_Mm01_00220358 predicted 4644
15 SASI_Mm01_00220359 predicted 4885
16 SASI_Mm01_00220360 predicted 4880
17 SASI_Mm01_00220361 predicted 5017
18 SASI_Mm01_00220362 predicted 5019
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_922989 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235484 predicted 5738
2 SASI_Mm02_00443592 predicted 5585
3 SASI_Mm01_00235487 predicted 5069
4 SASI_Mm02_00443593 predicted 5005
5 SASI_Mm02_00443594 predicted 5006
6 SASI_Mm02_00443595 predicted 5062
7 SASI_Mm02_00443596 predicted 5069
8 SASI_Mm02_00443597 predicted 5075
9 SASI_Mm02_00443598 predicted 5679
10 SASI_Mm02_00443599 predicted 5690
11 SASI_Mm01_00235482 predicted 5183
12 SASI_Mm01_00235483 predicted 5814
13 SASI_Mm01_00235485 predicted 5025
14 SASI_Mm01_00235486 predicted 5361
15 SASI_Mm01_00235488 predicted 4972
16 SASI_Mm01_00235489 predicted 4802
17 SASI_Mm01_00235490 predicted 5210
18 SASI_Mm01_00235491 predicted 5345
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_923034 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443655 predicted 2130
2 SASI_Mm02_00443656 predicted 2743
3 SASI_Mm02_00443657 predicted 1226
4 SASI_Mm02_00443658 predicted 4743
5 SASI_Mm02_00443659 predicted 827
6 SASI_Mm02_00443660 predicted 3698
7 SASI_Mm02_00443661 predicted 4868
8 SASI_Mm02_00443662 predicted 5012
9 SASI_Mm02_00443663 predicted 4237
10 SASI_Mm02_00443664 predicted 4927
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015091
VALIDATED
FAM179B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 179, member B
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015091.1-5108s1c1
Sequence:CCGGGCTGATATTGTTACGGAACTTCTCGAGAAGTTCCGTAACAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015091.1-3297s1c1
Sequence:CCGGGCCAAGAATCATTGACTTCTTCTCGAGAAGAAGTCAATGATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015091.1-4209s1c1
Sequence:CCGGGCATGGATCAAGAGCTAGATACTCGAGTATCTAGCTCTTGATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015091.1-758s1c1
Sequence:CCGGCCTCAACTAGTTGTCTCGTTACTCGAGTAACGAGACAACTAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015091.1-4676s1c1
Sequence:CCGGGCTGAGTACCTTAAACTCATACTCGAGTATGAGTTTAAGGTACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147246    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015091.1-5750s1c1
Sequence:CCGGGTCTCATTTCTCAGCCTTATTCTCGAGAATAAGGCTGAGAAATGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-4712s21c1
Sequence:CCGGAGACTTTCGTGATCGTATTAACTCGAGTTAATACGATCACGAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-1268s21c1
Sequence:CCGGGGAGCTGCATTCACGATTATTCTCGAGAATAATCGTGAATGCAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015091.2-5667s21c1
Sequence:CCGGTACAATTTGTTGCCCTATATGCTCGAGCATATAGGGCAACAAATTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-5231s21c1
Sequence:CCGGACGAACAGCCACAGCTAAATTCTCGAGAATTTAGCTGTGGCTGTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-4896s21c1
Sequence:CCGGGACCACTTATCTCCTATAATCCTCGAGGATTATAGGAGATAAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-1501s21c1
Sequence:CCGGAGTTCTTGGGACCAGTTATAGCTCGAGCTATAACTGGTCCCAAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015091.2-5791s21c1
Sequence:CCGGTGTTATCAGAAACTAAGTTTGCTCGAGCAAACTTAGTTTCTGATAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-2912s21c1
Sequence:CCGGATCTTCCCGACGAGGTCTAAACTCGAGTTTAGACCTCGTCGGGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015091.2-5527s21c1
Sequence:CCGGTATCAACCTTACCACTTATATCTCGAGATATAAGTGGTAAGGTTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-3636s21c1
Sequence:CCGGGAACCACCATCAGGGATTTATCTCGAGATAAATCCCTGATGGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015091
VALIDATED
FAM179B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 179, member B
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015091.1-5108s1c1
Sequence:CCGGGCTGATATTGTTACGGAACTTCTCGAGAAGTTCCGTAACAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015091.1-3297s1c1
Sequence:CCGGGCCAAGAATCATTGACTTCTTCTCGAGAAGAAGTCAATGATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015091.1-4209s1c1
Sequence:CCGGGCATGGATCAAGAGCTAGATACTCGAGTATCTAGCTCTTGATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015091.1-758s1c1
Sequence:CCGGCCTCAACTAGTTGTCTCGTTACTCGAGTAACGAGACAACTAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015091.1-4676s1c1
Sequence:CCGGGCTGAGTACCTTAAACTCATACTCGAGTATGAGTTTAAGGTACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147246    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015091.1-5750s1c1
Sequence:CCGGGTCTCATTTCTCAGCCTTATTCTCGAGAATAAGGCTGAGAAATGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-4712s21c1
Sequence:CCGGAGACTTTCGTGATCGTATTAACTCGAGTTAATACGATCACGAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-1268s21c1
Sequence:CCGGGGAGCTGCATTCACGATTATTCTCGAGAATAATCGTGAATGCAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015091.2-5667s21c1
Sequence:CCGGTACAATTTGTTGCCCTATATGCTCGAGCATATAGGGCAACAAATTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-5231s21c1
Sequence:CCGGACGAACAGCCACAGCTAAATTCTCGAGAATTTAGCTGTGGCTGTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-4896s21c1
Sequence:CCGGGACCACTTATCTCCTATAATCCTCGAGGATTATAGGAGATAAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-1501s21c1
Sequence:CCGGAGTTCTTGGGACCAGTTATAGCTCGAGCTATAACTGGTCCCAAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015091.2-5791s21c1
Sequence:CCGGTGTTATCAGAAACTAAGTTTGCTCGAGCAAACTTAGTTTCTGATAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-2912s21c1
Sequence:CCGGATCTTCCCGACGAGGTCTAAACTCGAGTTTAGACCTCGTCGGGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015091.2-5527s21c1
Sequence:CCGGTATCAACCTTACCACTTATATCTCGAGATATAAGTGGTAAGGTTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-3636s21c1
Sequence:CCGGGAACCACCATCAGGGATTTATCTCGAGATAAATCCCTGATGGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015091
VALIDATED
FAM179B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 179, member B
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015091.1-5108s1c1
Sequence:CCGGGCTGATATTGTTACGGAACTTCTCGAGAAGTTCCGTAACAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015091.1-3297s1c1
Sequence:CCGGGCCAAGAATCATTGACTTCTTCTCGAGAAGAAGTCAATGATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015091.1-4209s1c1
Sequence:CCGGGCATGGATCAAGAGCTAGATACTCGAGTATCTAGCTCTTGATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015091.1-758s1c1
Sequence:CCGGCCTCAACTAGTTGTCTCGTTACTCGAGTAACGAGACAACTAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015091.1-4676s1c1
Sequence:CCGGGCTGAGTACCTTAAACTCATACTCGAGTATGAGTTTAAGGTACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147246    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015091.1-5750s1c1
Sequence:CCGGGTCTCATTTCTCAGCCTTATTCTCGAGAATAAGGCTGAGAAATGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-4712s21c1
Sequence:CCGGAGACTTTCGTGATCGTATTAACTCGAGTTAATACGATCACGAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-1268s21c1
Sequence:CCGGGGAGCTGCATTCACGATTATTCTCGAGAATAATCGTGAATGCAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015091.2-5667s21c1
Sequence:CCGGTACAATTTGTTGCCCTATATGCTCGAGCATATAGGGCAACAAATTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-5231s21c1
Sequence:CCGGACGAACAGCCACAGCTAAATTCTCGAGAATTTAGCTGTGGCTGTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-4896s21c1
Sequence:CCGGGACCACTTATCTCCTATAATCCTCGAGGATTATAGGAGATAAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-1501s21c1
Sequence:CCGGAGTTCTTGGGACCAGTTATAGCTCGAGCTATAACTGGTCCCAAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015091.2-5791s21c1
Sequence:CCGGTGTTATCAGAAACTAAGTTTGCTCGAGCAAACTTAGTTTCTGATAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-2912s21c1
Sequence:CCGGATCTTCCCGACGAGGTCTAAACTCGAGTTTAGACCTCGTCGGGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015091.2-5527s21c1
Sequence:CCGGTATCAACCTTACCACTTATATCTCGAGATATAAGTGGTAAGGTTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015091.2-3636s21c1
Sequence:CCGGGAACCACCATCAGGGATTTATCTCGAGATAAATCCCTGATGGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177805
VALIDATED
FAM179B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 179, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177805.3-5973s21c1
Sequence:CCGGGAAGTGGAAGAAACGTCATTTCTCGAGAAATGACGTTTCTTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177805.3-4492s21c1
Sequence:CCGGGGATATGGCTGATCGTTTATTCTCGAGAATAAACGATCAGCCATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177805.3-4458s21c1
Sequence:CCGGGTATGGACCCAGAGCGAATTTCTCGAGAAATTCGCTCTGGGTCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177805.3-4906s21c1
Sequence:CCGGAGACTTTCGTGATCGTATTAACTCGAGTTAATACGATCACGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177805.3-3850s21c1
Sequence:CCGGGAATCCCTGGGAACGAATAAACTCGAGTTTATTCGTTCCCAGGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177805
VALIDATED
FAM179B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 179, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177805.3-5973s21c1
Sequence:CCGGGAAGTGGAAGAAACGTCATTTCTCGAGAAATGACGTTTCTTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177805.3-4492s21c1
Sequence:CCGGGGATATGGCTGATCGTTTATTCTCGAGAATAAACGATCAGCCATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177805.3-4458s21c1
Sequence:CCGGGTATGGACCCAGAGCGAATTTCTCGAGAAATTCGCTCTGGGTCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177805.3-4906s21c1
Sequence:CCGGAGACTTTCGTGATCGTATTAACTCGAGTTAATACGATCACGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177805.3-3850s21c1
Sequence:CCGGGAATCCCTGGGAACGAATAAACTCGAGTTTATTCGTTCCCAGGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177805
VALIDATED
FAM179B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 179, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177805.3-5973s21c1
Sequence:CCGGGAAGTGGAAGAAACGTCATTTCTCGAGAAATGACGTTTCTTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177805.3-4492s21c1
Sequence:CCGGGGATATGGCTGATCGTTTATTCTCGAGAATAAACGATCAGCCATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177805.3-4458s21c1
Sequence:CCGGGTATGGACCCAGAGCGAATTTCTCGAGAAATTCGCTCTGGGTCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177805.3-4906s21c1
Sequence:CCGGAGACTTTCGTGATCGTATTAACTCGAGTTAATACGATCACGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177805.3-3850s21c1
Sequence:CCGGGAATCCCTGGGAACGAATAAACTCGAGTTTATTCGTTCCCAGGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks