EMAIL THIS PAGE TO A FRIEND

FAM180A

family with sequence similarity 180, member A

50 Gene Product Result for
Synonyms: UNQ1940
UniProtKB ID: Q6UWF9, B2RP85
Gene ID:
Mouse(208164) family with sequence similarity 180, member A
Rat(362336) family with sequence similarity 180, member A
sheep(101108221) family with sequence similarity 180, member A
domestic guinea pig(100723291) family with sequence similarity 180, member A
naked mole-rat(101713239) family with sequence similarity 180, member A
chicken(772003) family with sequence similarity 180, member A
dog(610234) family with sequence similarity 180, member A
cow(616777) family with sequence similarity 180, member A
domestic cat(101099365) family with sequence similarity 180, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_205855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_205855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_205855 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_205855 Rosetta Predictions human pricing
NM_001108621 Rosetta Predictions rat pricing
NM_173375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153445 predicted 856
2 SASI_Hs01_00153446 predicted 813
3 SASI_Hs01_00153447 predicted 787
4 SASI_Hs01_00153448 predicted 815
5 SASI_Hs01_00153449 predicted 623
6 SASI_Hs01_00153450 predicted 891
7 SASI_Hs01_00153451 predicted 514
8 SASI_Hs01_00153452 predicted 851
9 SASI_Hs01_00153453 predicted 886
10 SASI_Hs01_00153454 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240439 predicted 798
2 SASI_Rn02_00240440 predicted 226
3 SASI_Rn02_00240441 predicted 588
4 SASI_Rn02_00240442 predicted 332
5 SASI_Rn02_00240443 predicted 482
6 SASI_Rn02_00240444 predicted 804
7 SASI_Rn02_00240445 predicted 616
8 SASI_Rn02_00240446 predicted 591
9 SASI_Rn02_00240447 predicted 981
10 SASI_Rn02_00240448 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123092 predicted 744
2 SASI_Mm01_00123093 predicted 923
3 SASI_Mm01_00123094 predicted 915
4 SASI_Mm01_00123095 predicted 799
5 SASI_Mm01_00123096 predicted 1016
6 SASI_Mm01_00123097 predicted 908
7 SASI_Mm01_00123098 predicted 526
8 SASI_Mm01_00123099 predicted 747
9 SASI_Mm01_00123100 predicted 488
10 SASI_Mm01_00123101 predicted 893
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_205855
FAM180A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 180, member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205855.3-1288s21c1
Sequence:CCGGCTGCAGGTCCAATGGTCTAAACTCGAGTTTAGACCATTGGACCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205855.3-303s21c1
Sequence:CCGGTACAATGCTGAGGCTTCTATGCTCGAGCATAGAAGCCTCAGCATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205855.3-1257s21c1
Sequence:CCGGCTCACCTTGAATCTAACAAATCTCGAGATTTGTTAGATTCAAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205855.1-152s1c1
Sequence:CCGGGTATTACAATGCTGAGGCTTCCTCGAGGAAGCCTCAGCATTGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205855.1-230s1c1
Sequence:CCGGGTCCTCATCACTGCCATTGAACTCGAGTTCAATGGCAGTGATGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168132    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205855.1-756s1c1
Sequence:CCGGGCAGCAGAGATCAAACAGTAACTCGAGTTACTGTTTGATCTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168000    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205855.1-1332s1c1
Sequence:CCGGCCGGAACTTTCTCATCTTGTACTCGAGTACAAGATGAGAAAGTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167120    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205855.1-689s1c1
Sequence:CCGGCCAGAAAGTCTTCATTCTCTACTCGAGTAGAGAATGAAGACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166869    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205855.1-1195s1c1
Sequence:CCGGCCCTTACTTTCCTAATCCATTCTCGAGAATGGATTAGGAAAGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205855.1-146s1c1
Sequence:CCGGGCTGTTGTATTACAATGCTGACTCGAGTCAGCATTGTAATACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_205855
FAM180A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 180, member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205855.3-1288s21c1
Sequence:CCGGCTGCAGGTCCAATGGTCTAAACTCGAGTTTAGACCATTGGACCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205855.3-303s21c1
Sequence:CCGGTACAATGCTGAGGCTTCTATGCTCGAGCATAGAAGCCTCAGCATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205855.3-1257s21c1
Sequence:CCGGCTCACCTTGAATCTAACAAATCTCGAGATTTGTTAGATTCAAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205855.1-152s1c1
Sequence:CCGGGTATTACAATGCTGAGGCTTCCTCGAGGAAGCCTCAGCATTGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205855.1-230s1c1
Sequence:CCGGGTCCTCATCACTGCCATTGAACTCGAGTTCAATGGCAGTGATGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168132    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205855.1-756s1c1
Sequence:CCGGGCAGCAGAGATCAAACAGTAACTCGAGTTACTGTTTGATCTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168000    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205855.1-1332s1c1
Sequence:CCGGCCGGAACTTTCTCATCTTGTACTCGAGTACAAGATGAGAAAGTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167120    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205855.1-689s1c1
Sequence:CCGGCCAGAAAGTCTTCATTCTCTACTCGAGTAGAGAATGAAGACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166869    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205855.1-1195s1c1
Sequence:CCGGCCCTTACTTTCCTAATCCATTCTCGAGAATGGATTAGGAAAGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205855.1-146s1c1
Sequence:CCGGGCTGTTGTATTACAATGCTGACTCGAGTCAGCATTGTAATACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_205855
FAM180A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 180, member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205855.3-1288s21c1
Sequence:CCGGCTGCAGGTCCAATGGTCTAAACTCGAGTTTAGACCATTGGACCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205855.3-303s21c1
Sequence:CCGGTACAATGCTGAGGCTTCTATGCTCGAGCATAGAAGCCTCAGCATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205855.3-1257s21c1
Sequence:CCGGCTCACCTTGAATCTAACAAATCTCGAGATTTGTTAGATTCAAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205855.1-152s1c1
Sequence:CCGGGTATTACAATGCTGAGGCTTCCTCGAGGAAGCCTCAGCATTGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205855.1-230s1c1
Sequence:CCGGGTCCTCATCACTGCCATTGAACTCGAGTTCAATGGCAGTGATGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168132    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205855.1-756s1c1
Sequence:CCGGGCAGCAGAGATCAAACAGTAACTCGAGTTACTGTTTGATCTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168000    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205855.1-1332s1c1
Sequence:CCGGCCGGAACTTTCTCATCTTGTACTCGAGTACAAGATGAGAAAGTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167120    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205855.1-689s1c1
Sequence:CCGGCCAGAAAGTCTTCATTCTCTACTCGAGTAGAGAATGAAGACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166869    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205855.1-1195s1c1
Sequence:CCGGCCCTTACTTTCCTAATCCATTCTCGAGAATGGATTAGGAAAGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205855.1-146s1c1
Sequence:CCGGGCTGTTGTATTACAATGCTGACTCGAGTCAGCATTGTAATACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173375
FAM180A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 180, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173375.1-602s1c1
Sequence:CCGGGATAACATTAACCCTGGCGTACTCGAGTACGCCAGGGTTAATGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173375.1-584s1c1
Sequence:CCGGGAAAGAAGACTTTGAGAGGATCTCGAGATCCTCTCAAAGTCTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173375.1-490s1c1
Sequence:CCGGGTTTCCACTCAATCTGCAATACTCGAGTATTGCAGATTGAGTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173375.1-848s1c1
Sequence:CCGGCCCACACAGAATAGCAAAGATCTCGAGATCTTTGCTATTCTGTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173375.1-1294s1c1
Sequence:CCGGCCCTATCATTTCAATGTAGAACTCGAGTTCTACATTGAAATGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173375
FAM180A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 180, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173375.1-602s1c1
Sequence:CCGGGATAACATTAACCCTGGCGTACTCGAGTACGCCAGGGTTAATGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173375.1-584s1c1
Sequence:CCGGGAAAGAAGACTTTGAGAGGATCTCGAGATCCTCTCAAAGTCTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173375.1-490s1c1
Sequence:CCGGGTTTCCACTCAATCTGCAATACTCGAGTATTGCAGATTGAGTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173375.1-848s1c1
Sequence:CCGGCCCACACAGAATAGCAAAGATCTCGAGATCTTTGCTATTCTGTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173375.1-1294s1c1
Sequence:CCGGCCCTATCATTTCAATGTAGAACTCGAGTTCTACATTGAAATGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173375
FAM180A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 180, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173375.1-602s1c1
Sequence:CCGGGATAACATTAACCCTGGCGTACTCGAGTACGCCAGGGTTAATGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173375.1-584s1c1
Sequence:CCGGGAAAGAAGACTTTGAGAGGATCTCGAGATCCTCTCAAAGTCTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173375.1-490s1c1
Sequence:CCGGGTTTCCACTCAATCTGCAATACTCGAGTATTGCAGATTGAGTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173375.1-848s1c1
Sequence:CCGGCCCACACAGAATAGCAAAGATCTCGAGATCTTTGCTATTCTGTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173375.1-1294s1c1
Sequence:CCGGCCCTATCATTTCAATGTAGAACTCGAGTTCTACATTGAAATGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks