EMAIL THIS PAGE TO A FRIEND

FAM180B

family with sequence similarity 180, member B

36 Gene Product Result for
UniProtKB ID: Q6P0A1
Gene ID:
chicken(101748745) family with sequence similarity 180, member B
chicken(101668332) family with sequence similarity 180, member B
cow(100138344) family with sequence similarity 180, member B
domestic cat(101097170) family with sequence similarity 180, member B
dog(100685781) family with sequence similarity 180, member B
naked mole-rat(101697372) family with sequence similarity 180, member B
domestic guinea pig(100728499) family with sequence similarity 180, member B
sheep(101119248) family with sequence similarity 180, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001164379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001164379 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139181 MISSION® esiRNA esiRNA human FAM180B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001716425 Rosetta Predictions human pricing
XM_374880 Rosetta Predictions human pricing
XM_941808 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00410476 predicted 452
2 SASI_Hs02_00410477 predicted 364
3 SASI_Hs02_00410478 predicted 586
4 SASI_Hs02_00410479 predicted 445
5 SASI_Hs02_00410480 predicted 262
6 SASI_Hs02_00410481 predicted 457
7 SASI_Hs02_00410482 predicted 559
8 SASI_Hs02_00410483 predicted 391
9 SASI_Hs02_00410484 predicted 456
10 SASI_Hs02_00410485 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_374880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248966 predicted 456
2 SASI_Hs01_00248967 predicted 360
3 SASI_Hs01_00248968 predicted 586
4 SASI_Hs01_00248969 predicted 450
5 SASI_Hs01_00248970 predicted 259
6 SASI_Hs01_00248971 predicted 455
7 SASI_Hs01_00248972 predicted 392
8 SASI_Hs01_00248973 predicted 559
9 SASI_Hs01_00248975 predicted 462
10 SASI_Hs02_00479687 predicted 463
11 SASI_Hs01_00248974 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485117 predicted 450
2 SASI_Hs02_00485118 predicted 360
3 SASI_Hs02_00485119 predicted 578
4 SASI_Hs02_00485120 predicted 452
5 SASI_Hs02_00485121 predicted 262
6 SASI_Hs02_00485122 predicted 457
7 SASI_Hs02_00485123 predicted 559
8 SASI_Hs02_00485124 predicted 392
9 SASI_Hs02_00485125 predicted 460
10 SASI_Hs02_00485126 predicted 467
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164379
FAM180B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 180, member B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164379.1-534s21c1
Sequence:CCGGTCGCTCTCCTGGCACAGGAAACTCGAGTTTCCTGTGCCAGGAGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164379.1-827s21c1
Sequence:CCGGCCTAGATCTTGAGAGGCTAAGCTCGAGCTTAGCCTCTCAAGATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164379.1-426s21c1
Sequence:CCGGCTCTTAGCACTTGGGACTTTGCTCGAGCAAAGTCCCAAGTGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164379.1-117s21c1
Sequence:CCGGTTTGCCTGGTGGTAGCCATTTCTCGAGAAATGGCTACCACCAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164379.1-290s21c1
Sequence:CCGGCACATCCAGGATGAGGAACTACTCGAGTAGTTCCTCATCCTGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164379.1-142s21c1
Sequence:CCGGCCTCTCTGGTGTGACTACAACCTCGAGGTTGTAGTCACACCAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164379.1-655s21c1
Sequence:CCGGTGTTCTTTCACCTGCCATTACCTCGAGGTAATGGCAGGTGAAAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164379
FAM180B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 180, member B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164379.1-534s21c1
Sequence:CCGGTCGCTCTCCTGGCACAGGAAACTCGAGTTTCCTGTGCCAGGAGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164379.1-827s21c1
Sequence:CCGGCCTAGATCTTGAGAGGCTAAGCTCGAGCTTAGCCTCTCAAGATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164379.1-426s21c1
Sequence:CCGGCTCTTAGCACTTGGGACTTTGCTCGAGCAAAGTCCCAAGTGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164379.1-117s21c1
Sequence:CCGGTTTGCCTGGTGGTAGCCATTTCTCGAGAAATGGCTACCACCAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164379.1-290s21c1
Sequence:CCGGCACATCCAGGATGAGGAACTACTCGAGTAGTTCCTCATCCTGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164379.1-142s21c1
Sequence:CCGGCCTCTCTGGTGTGACTACAACCTCGAGGTTGTAGTCACACCAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164379.1-655s21c1
Sequence:CCGGTGTTCTTTCACCTGCCATTACCTCGAGGTAATGGCAGGTGAAAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164379
FAM180B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 180, member B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164379.1-534s21c1
Sequence:CCGGTCGCTCTCCTGGCACAGGAAACTCGAGTTTCCTGTGCCAGGAGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164379.1-827s21c1
Sequence:CCGGCCTAGATCTTGAGAGGCTAAGCTCGAGCTTAGCCTCTCAAGATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164379.1-426s21c1
Sequence:CCGGCTCTTAGCACTTGGGACTTTGCTCGAGCAAAGTCCCAAGTGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164379.1-117s21c1
Sequence:CCGGTTTGCCTGGTGGTAGCCATTTCTCGAGAAATGGCTACCACCAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164379.1-290s21c1
Sequence:CCGGCACATCCAGGATGAGGAACTACTCGAGTAGTTCCTCATCCTGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164379.1-142s21c1
Sequence:CCGGCCTCTCTGGTGTGACTACAACCTCGAGGTTGTAGTCACACCAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164379.1-655s21c1
Sequence:CCGGTGTTCTTTCACCTGCCATTACCTCGAGGTAATGGCAGGTGAAAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks