EMAIL THIS PAGE TO A FRIEND

FAM181A

family with sequence similarity 181, member A

21 Gene Product Result for
Synonyms: C14orf152
UniProtKB ID: Q8N9Y4, B2RD39, Q96GY1
Gene ID:
Mouse(100504156) family with sequence similarity 181, member A
sheep(101113799) family with sequence similarity 181, member A
domestic guinea pig(100735794) family with sequence similarity 181, member A
naked mole-rat(101704608) family with sequence similarity 181, member A
chicken(423427) family with sequence similarity 181, member A
domestic cat(101101142) family with sequence similarity 181, member A
dog(612352) family with sequence similarity 181, member A
cow(540449) family with sequence similarity 181, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA001603 Anti-FAM181A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138344 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138344 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138344 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138344 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064043 predicted 325
2 SASI_Hs01_00064044 predicted 480
3 SASI_Hs01_00064045 predicted 1032
4 SASI_Hs01_00064046 predicted 452
5 SASI_Hs02_00363433 predicted 483
6 SASI_Hs01_00064047 predicted 500
7 SASI_Hs01_00064048 predicted 437
8 SASI_Hs01_00064049 predicted 881
9 SASI_Hs01_00064051 predicted 1457
10 SASI_Hs01_00064052 predicted 402
11 SASI_Hs01_00064050 predicted 835
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138344
FAM181A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 181, member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138344.3-1032s21c1
Sequence:CCGGAGACTACCCTGGTGTCCATGTCTCGAGACATGGACACCAGGGTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138344.3-978s21c1
Sequence:CCGGGACCTCCCTATGAGGGTAAGACTCGAGTCTTACCCTCATAGGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138344.3-632s21c1
Sequence:CCGGCGCTTCTCCCAGAAGTATTCCCTCGAGGGAATACTTCTGGGAGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138344.3-555s21c1
Sequence:CCGGTCAAGGCAGCCCTGGATAAGTCTCGAGACTTATCCAGGGCTGCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138344.3-800s21c1
Sequence:CCGGCCCTACAGGGAGGAATGTCTTCTCGAGAAGACATTCCTCCCTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138344.2-1351s1c1
Sequence:CCGGCTTCAATGTCTTTGGCTACCTCTCGAGAGGTAGCCAAAGACATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138344.2-1348s1c1
Sequence:CCGGCATCTTCAATGTCTTTGGCTACTCGAGTAGCCAAAGACATTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138344.2-1113s1c1
Sequence:CCGGGCCGCGTCAATGCCTGGAGTTCTCGAGAACTCCAGGCATTGACGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138344.2-1342s1c1
Sequence:CCGGCCCACCCATCTTCAATGTCTTCTCGAGAAGACATTGAAGATGGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138344.2-1637s1c1
Sequence:CCGGGACCATAGGTACTGGGATGTTCTCGAGAACATCCCAGTACCTATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138344
FAM181A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 181, member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138344.3-1032s21c1
Sequence:CCGGAGACTACCCTGGTGTCCATGTCTCGAGACATGGACACCAGGGTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138344.3-978s21c1
Sequence:CCGGGACCTCCCTATGAGGGTAAGACTCGAGTCTTACCCTCATAGGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138344.3-632s21c1
Sequence:CCGGCGCTTCTCCCAGAAGTATTCCCTCGAGGGAATACTTCTGGGAGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138344.3-555s21c1
Sequence:CCGGTCAAGGCAGCCCTGGATAAGTCTCGAGACTTATCCAGGGCTGCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138344.3-800s21c1
Sequence:CCGGCCCTACAGGGAGGAATGTCTTCTCGAGAAGACATTCCTCCCTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138344.2-1351s1c1
Sequence:CCGGCTTCAATGTCTTTGGCTACCTCTCGAGAGGTAGCCAAAGACATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138344.2-1348s1c1
Sequence:CCGGCATCTTCAATGTCTTTGGCTACTCGAGTAGCCAAAGACATTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138344.2-1113s1c1
Sequence:CCGGGCCGCGTCAATGCCTGGAGTTCTCGAGAACTCCAGGCATTGACGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138344.2-1342s1c1
Sequence:CCGGCCCACCCATCTTCAATGTCTTCTCGAGAAGACATTGAAGATGGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138344.2-1637s1c1
Sequence:CCGGGACCATAGGTACTGGGATGTTCTCGAGAACATCCCAGTACCTATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138344
FAM181A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 181, member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138344.3-1032s21c1
Sequence:CCGGAGACTACCCTGGTGTCCATGTCTCGAGACATGGACACCAGGGTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138344.3-978s21c1
Sequence:CCGGGACCTCCCTATGAGGGTAAGACTCGAGTCTTACCCTCATAGGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138344.3-632s21c1
Sequence:CCGGCGCTTCTCCCAGAAGTATTCCCTCGAGGGAATACTTCTGGGAGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138344.3-555s21c1
Sequence:CCGGTCAAGGCAGCCCTGGATAAGTCTCGAGACTTATCCAGGGCTGCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138344.3-800s21c1
Sequence:CCGGCCCTACAGGGAGGAATGTCTTCTCGAGAAGACATTCCTCCCTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138344.2-1351s1c1
Sequence:CCGGCTTCAATGTCTTTGGCTACCTCTCGAGAGGTAGCCAAAGACATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138344.2-1348s1c1
Sequence:CCGGCATCTTCAATGTCTTTGGCTACTCGAGTAGCCAAAGACATTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138344.2-1113s1c1
Sequence:CCGGGCCGCGTCAATGCCTGGAGTTCTCGAGAACTCCAGGCATTGACGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138344.2-1342s1c1
Sequence:CCGGCCCACCCATCTTCAATGTCTTCTCGAGAAGACATTGAAGATGGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138344.2-1637s1c1
Sequence:CCGGGACCATAGGTACTGGGATGTTCTCGAGAACATCCCAGTACCTATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks