EMAIL THIS PAGE TO A FRIEND

FAM181B

family with sequence similarity 181, member B

45 Gene Product Result for
UniProtKB ID: A6NEQ2, B2RWP1
Gene ID:
Mouse(58238) family with sequence similarity 181, member B
Rat(499205) family with sequence similarity 181, member B
chicken(101666062) family with sequence similarity 181, member B
chicken(101751376) family with sequence similarity 181, member B
cow(613623) family with sequence similarity 181, member B
domestic cat(101084220) family with sequence similarity 181, member B
naked mole-rat(101721113) family with sequence similarity 181, member B
domestic guinea pig(100731280) family with sequence similarity 181, member B
sheep(101114735) family with sequence similarity 181, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0574 AQUA Peptide GAAPPG[V]TR human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021427 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021427 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021427 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175885 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175885 Rosetta Predictions human pricing
NM_001109150 Rosetta Predictions rat pricing
NM_021427 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193812 predicted 800
2 SASI_Hs01_00193814 predicted 1617
3 SASI_Hs01_00193815 predicted 1291
4 SASI_Hs01_00193816 predicted 802
5 SASI_Hs01_00193817 predicted 1337
6 SASI_Hs02_00369160 predicted 1334
7 SASI_Hs01_00193818 predicted 1626
8 SASI_Hs01_00193819 predicted 1338
9 SASI_Hs01_00193820 predicted 1467
10 SASI_Hs01_00193821 predicted 1416
11 SASI_Hs01_00193813 predicted 1511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245620 predicted 1228
2 SASI_Rn02_00245621 predicted 892
3 SASI_Rn02_00245622 predicted 334
4 SASI_Rn02_00245623 predicted 905
5 SASI_Rn02_00245624 predicted 861
6 SASI_Rn02_00245625 predicted 864
7 SASI_Rn02_00245626 predicted 1100
8 SASI_Rn02_00245627 predicted 673
9 SASI_Rn02_00245628 predicted 911
10 SASI_Rn02_00245629 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096674 predicted 905
2 SASI_Mm01_00096675 predicted 240
3 SASI_Mm01_00096676 predicted 1271
4 SASI_Mm01_00096677 predicted 948
5 SASI_Mm02_00326063 predicted 217
6 SASI_Mm01_00096678 predicted 386
7 SASI_Mm01_00096679 predicted 945
8 SASI_Mm02_00326064 predicted 431
9 SASI_Mm01_00096682 predicted 950
10 SASI_Mm01_00096683 predicted 383
11 SASI_Mm01_00096680 predicted 397
12 SASI_Mm01_00096681 predicted 358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021427
FAM181B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 181, member B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021427.1-369s1c1
Sequence:CCGGGAAAGTGAACCACCGCAAGTACTCGAGTACTTGCGGTGGTTCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021427.1-771s1c1
Sequence:CCGGGTCCTTCTTCACTGAACCATCCTCGAGGATGGTTCAGTGAAGAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021427.1-1443s1c1
Sequence:CCGGGAACGCAAGTAAAGACGAAATCTCGAGATTTCGTCTTTACTTGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021427.1-1502s1c1
Sequence:CCGGCAAACCCTCAATCCATTTAATCTCGAGATTAAATGGATTGAGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021427
FAM181B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 181, member B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021427.1-369s1c1
Sequence:CCGGGAAAGTGAACCACCGCAAGTACTCGAGTACTTGCGGTGGTTCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021427.1-771s1c1
Sequence:CCGGGTCCTTCTTCACTGAACCATCCTCGAGGATGGTTCAGTGAAGAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021427.1-1443s1c1
Sequence:CCGGGAACGCAAGTAAAGACGAAATCTCGAGATTTCGTCTTTACTTGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021427.1-1502s1c1
Sequence:CCGGCAAACCCTCAATCCATTTAATCTCGAGATTAAATGGATTGAGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021427
FAM181B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 181, member B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021427.1-369s1c1
Sequence:CCGGGAAAGTGAACCACCGCAAGTACTCGAGTACTTGCGGTGGTTCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021427.1-771s1c1
Sequence:CCGGGTCCTTCTTCACTGAACCATCCTCGAGGATGGTTCAGTGAAGAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021427.1-1443s1c1
Sequence:CCGGGAACGCAAGTAAAGACGAAATCTCGAGATTTCGTCTTTACTTGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021427.1-1502s1c1
Sequence:CCGGCAAACCCTCAATCCATTTAATCTCGAGATTAAATGGATTGAGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175885
FAM181B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 181, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175885.2-348s1c1
Sequence:CCGGCTCGGCGTCCAGCAACATCAACTCGAGTTGATGTTGCTGGACGCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143301    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175885.3-1659s1c1
Sequence:CCGGGAGGAGTCAAGAAACCAAGATCTCGAGATCTTGGTTTCTTGACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175885.3-1656s1c1
Sequence:CCGGCCAGAGGAGTCAAGAAACCAACTCGAGTTGGTTTCTTGACTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175885.3-1511s1c1
Sequence:CCGGCGTGGAGATGAAACCAGATTTCTCGAGAAATCTGGTTTCATCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175885.3-1467s1c1
Sequence:CCGGCTCCGTGGGTTTCTCCTAAATCTCGAGATTTAGGAGAAACCCACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175885.3-1343s1c1
Sequence:CCGGCCTATTCCAGCCTTTGGAGATCTCGAGATCTCCAAAGGCTGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175885.3-325s1c1
Sequence:CCGGCGCGATCTACTCAGCTTCATTCTCGAGAATGAAGCTGAGTAGATCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175885.3-1597s21c1
Sequence:CCGGATCACAACCTCAAGTGTTAAACTCGAGTTTAACACTTGAGGTTGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175885.3-1422s21c1
Sequence:CCGGAGGCACGCTTCCCTTCATTAGCTCGAGCTAATGAAGGGAAGCGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175885
FAM181B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 181, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175885.2-348s1c1
Sequence:CCGGCTCGGCGTCCAGCAACATCAACTCGAGTTGATGTTGCTGGACGCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143301    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175885.3-1659s1c1
Sequence:CCGGGAGGAGTCAAGAAACCAAGATCTCGAGATCTTGGTTTCTTGACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175885.3-1656s1c1
Sequence:CCGGCCAGAGGAGTCAAGAAACCAACTCGAGTTGGTTTCTTGACTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175885.3-1511s1c1
Sequence:CCGGCGTGGAGATGAAACCAGATTTCTCGAGAAATCTGGTTTCATCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175885.3-1467s1c1
Sequence:CCGGCTCCGTGGGTTTCTCCTAAATCTCGAGATTTAGGAGAAACCCACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175885.3-1343s1c1
Sequence:CCGGCCTATTCCAGCCTTTGGAGATCTCGAGATCTCCAAAGGCTGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175885.3-325s1c1
Sequence:CCGGCGCGATCTACTCAGCTTCATTCTCGAGAATGAAGCTGAGTAGATCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175885.3-1597s21c1
Sequence:CCGGATCACAACCTCAAGTGTTAAACTCGAGTTTAACACTTGAGGTTGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175885.3-1422s21c1
Sequence:CCGGAGGCACGCTTCCCTTCATTAGCTCGAGCTAATGAAGGGAAGCGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175885
FAM181B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 181, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175885.2-348s1c1
Sequence:CCGGCTCGGCGTCCAGCAACATCAACTCGAGTTGATGTTGCTGGACGCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143301    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175885.3-1659s1c1
Sequence:CCGGGAGGAGTCAAGAAACCAAGATCTCGAGATCTTGGTTTCTTGACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175885.3-1656s1c1
Sequence:CCGGCCAGAGGAGTCAAGAAACCAACTCGAGTTGGTTTCTTGACTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175885.3-1511s1c1
Sequence:CCGGCGTGGAGATGAAACCAGATTTCTCGAGAAATCTGGTTTCATCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175885.3-1467s1c1
Sequence:CCGGCTCCGTGGGTTTCTCCTAAATCTCGAGATTTAGGAGAAACCCACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175885.3-1343s1c1
Sequence:CCGGCCTATTCCAGCCTTTGGAGATCTCGAGATCTCCAAAGGCTGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175885.3-325s1c1
Sequence:CCGGCGCGATCTACTCAGCTTCATTCTCGAGAATGAAGCTGAGTAGATCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175885.3-1597s21c1
Sequence:CCGGATCACAACCTCAAGTGTTAAACTCGAGTTTAACACTTGAGGTTGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175885.3-1422s21c1
Sequence:CCGGAGGCACGCTTCCCTTCATTAGCTCGAGCTAATGAAGGGAAGCGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks