EMAIL THIS PAGE TO A FRIEND

FAM182A

family with sequence similarity 182, member A

34 Gene Product Result for
Synonyms: C20orf91 bB329D4.1
Species: Human FAM182A(284800)
UniProtKB ID: Q5T1J6, A2RRD0, Q8N947
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182583 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182583 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182583 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182583 Rosetta Predictions human pricing
XR_041125 Rosetta Predictions human pricing
XR_041127 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095734 predicted 1581
2 SASI_Hs01_00095735 predicted 1195
3 SASI_Hs01_00095736 predicted 1363
4 SASI_Hs01_00095737 predicted 1130
5 SASI_Hs01_00095738 predicted 1502
6 SASI_Hs01_00095739 predicted 1018
7 SASI_Hs01_00095740 predicted 1109
8 SASI_Hs01_00095741 predicted 1153
9 SASI_Hs01_00095742 predicted 996
10 SASI_Hs01_00095743 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524865 predicted 105
2 SASI_Hs02_00524866 predicted 109
3 SASI_Hs02_00524867 predicted 63
4 SASI_Hs02_00524868 predicted 132
5 SASI_Hs02_00524869 predicted 32
6 SASI_Hs02_00524870 predicted 370
7 SASI_Hs02_00524871 predicted 93
8 SASI_Hs02_00524872 predicted 363
9 SASI_Hs02_00524873 predicted 100
10 SASI_Hs02_00524874 predicted 30
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524875 predicted 1934
2 SASI_Hs02_00524876 predicted 2445
3 SASI_Hs02_00524877 predicted 1557
4 SASI_Hs02_00524878 predicted 2083
5 SASI_Hs02_00524879 predicted 1122
6 SASI_Hs02_00524880 predicted 1143
7 SASI_Hs02_00524881 predicted 2480
8 SASI_Hs02_00524882 predicted 1035
9 SASI_Hs02_00524883 predicted 2242
10 SASI_Hs02_00524884 predicted 2295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182583
FAM182A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 182, member A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182583.1-1111s1c1
Sequence:CCGGGCAAGGAGCATGATGGTACTTCTCGAGAAGTACCATCATGCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182583.1-851s1c1
Sequence:CCGGGAGAGAACTTTGGATGTGGAACTCGAGTTCCACATCCAAAGTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182583.1-1020s1c1
Sequence:CCGGCAGAAGAGTGTCCACAAACTTCTCGAGAAGTTTGTGGACACTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182583.1-1326s1c1
Sequence:CCGGGATGTCTATCTGTGGCCTTATCTCGAGATAAGGCCACAGATAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182583.1-802s1c1
Sequence:CCGGCTGGAACTACTGTGAGGGTTTCTCGAGAAACCCTCACAGTAGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182583.1-2437s1c1
Sequence:CCGGCCACCTAGGAACCTGATGTATCTCGAGATACATCAGGTTCCTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182583
FAM182A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 182, member A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182583.1-1111s1c1
Sequence:CCGGGCAAGGAGCATGATGGTACTTCTCGAGAAGTACCATCATGCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182583.1-851s1c1
Sequence:CCGGGAGAGAACTTTGGATGTGGAACTCGAGTTCCACATCCAAAGTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182583.1-1020s1c1
Sequence:CCGGCAGAAGAGTGTCCACAAACTTCTCGAGAAGTTTGTGGACACTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182583.1-1326s1c1
Sequence:CCGGGATGTCTATCTGTGGCCTTATCTCGAGATAAGGCCACAGATAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182583.1-802s1c1
Sequence:CCGGCTGGAACTACTGTGAGGGTTTCTCGAGAAACCCTCACAGTAGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182583.1-2437s1c1
Sequence:CCGGCCACCTAGGAACCTGATGTATCTCGAGATACATCAGGTTCCTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182583
FAM182A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 182, member A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182583.1-1111s1c1
Sequence:CCGGGCAAGGAGCATGATGGTACTTCTCGAGAAGTACCATCATGCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182583.1-851s1c1
Sequence:CCGGGAGAGAACTTTGGATGTGGAACTCGAGTTCCACATCCAAAGTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182583.1-1020s1c1
Sequence:CCGGCAGAAGAGTGTCCACAAACTTCTCGAGAAGTTTGTGGACACTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182583.1-1326s1c1
Sequence:CCGGGATGTCTATCTGTGGCCTTATCTCGAGATAAGGCCACAGATAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182583.1-802s1c1
Sequence:CCGGCTGGAACTACTGTGAGGGTTTCTCGAGAAACCCTCACAGTAGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182583.1-2437s1c1
Sequence:CCGGCCACCTAGGAACCTGATGTATCTCGAGATACATCAGGTTCCTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks