EMAIL THIS PAGE TO A FRIEND

FAM183A

family with sequence similarity 183, member A

34 Gene Product Result for
UniProtKB ID: A6NL82, B7ZBL8
Gene ID:
chicken(424557) family with sequence similarity 183, member A
cow(782130) family with sequence similarity 183, member A
domestic cat(101096250) family with sequence similarity 183, member A
dog(100685382) family with sequence similarity 183, member A
sheep(101108699) family with sequence similarity 183, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101376 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101376 Rosetta Predictions human pricing
XM_496360 Rosetta Predictions human pricing
XM_933723 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322735 predicted 210
2 SASI_Hs02_00322736 predicted 291
3 SASI_Hs02_00322737 predicted 288
4 SASI_Hs02_00322738 predicted 262
5 SASI_Hs02_00322739 predicted 211
6 SASI_Hs02_00322740 predicted 267
7 SASI_Hs02_00322741 predicted 275
8 SASI_Hs02_00322742 predicted 252
9 SASI_Hs02_00322743 predicted 257
10 SASI_Hs02_00322744 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283106 predicted 295
2 SASI_Hs01_00283107 predicted 334
3 SASI_Hs01_00283108 predicted 305
4 SASI_Hs01_00283109 predicted 207
5 SASI_Hs01_00283110 predicted 334
6 SASI_Hs01_00283111 predicted 301
7 SASI_Hs01_00283112 predicted 319
8 SASI_Hs01_00283113 predicted 296
9 SASI_Hs01_00283114 predicted 295
10 SASI_Hs01_00283115 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256091 predicted 245
2 SASI_Hs01_00256092 predicted 242
3 SASI_Hs01_00256093 predicted 250
4 SASI_Hs01_00256094 predicted 254
5 SASI_Hs01_00256095 predicted 230
6 SASI_Hs01_00256096 predicted 232
7 SASI_Hs01_00256097 predicted 221
8 SASI_Hs01_00256098 predicted 228
9 SASI_Hs01_00256099 predicted 283
10 SASI_Hs01_00256100 predicted 133
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101376
FAM183A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 183, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101376.2-298s21c1
Sequence:CCGGAGGAAGTTGGATGGGACTTAGCTCGAGCTAAGTCCCATCCAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101376.2-344s21c1
Sequence:CCGGTGACCGCAGGCTGAATCACTTCTCGAGAAGTGATTCAGCCTGCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101376.2-121s21c1
Sequence:CCGGAGAAACTCTACACGCAGTATCCTCGAGGATACTGCGTGTAGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101376.2-56s21c1
Sequence:CCGGGATTCCAGATGAGGTCCATCACTCGAGTGATGGACCTCATCTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101376.2-151s21c1
Sequence:CCGGCCCTCCGCAAGATTCATACAGCTCGAGCTGTATGAATCTTGCGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101376
FAM183A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 183, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101376.2-298s21c1
Sequence:CCGGAGGAAGTTGGATGGGACTTAGCTCGAGCTAAGTCCCATCCAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101376.2-344s21c1
Sequence:CCGGTGACCGCAGGCTGAATCACTTCTCGAGAAGTGATTCAGCCTGCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101376.2-121s21c1
Sequence:CCGGAGAAACTCTACACGCAGTATCCTCGAGGATACTGCGTGTAGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101376.2-56s21c1
Sequence:CCGGGATTCCAGATGAGGTCCATCACTCGAGTGATGGACCTCATCTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101376.2-151s21c1
Sequence:CCGGCCCTCCGCAAGATTCATACAGCTCGAGCTGTATGAATCTTGCGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101376
FAM183A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 183, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101376.2-298s21c1
Sequence:CCGGAGGAAGTTGGATGGGACTTAGCTCGAGCTAAGTCCCATCCAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101376.2-344s21c1
Sequence:CCGGTGACCGCAGGCTGAATCACTTCTCGAGAAGTGATTCAGCCTGCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101376.2-121s21c1
Sequence:CCGGAGAAACTCTACACGCAGTATCCTCGAGGATACTGCGTGTAGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101376.2-56s21c1
Sequence:CCGGGATTCCAGATGAGGTCCATCACTCGAGTGATGGACCTCATCTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101376.2-151s21c1
Sequence:CCGGCCCTCCGCAAGATTCATACAGCTCGAGCTGTATGAATCTTGCGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks