EMAIL THIS PAGE TO A FRIEND

FAM183B

family with sequence similarity 183, member B

58 Gene Product Result for
UniProtKB ID: Q6ZVS7, A4D1Y1
Gene ID:
Mouse(75429) family with sequence similarity 183, member B
Rat(287346) family with sequence similarity 183, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001162878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001162878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001162878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001105282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105282 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004951 MISSION® esiRNA esiRNA targeting human FAM183B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105282 Rosetta Predictions human pricing
XM_295200 Rosetta Predictions human pricing
XM_213312 Rosetta Predictions rat pricing
XM_001002721 Rosetta Predictions mouse pricing
XM_001002726 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324114 predicted 1070
2 SASI_Hs02_00324115 predicted 1241
3 SASI_Hs02_00324116 predicted 1201
4 SASI_Hs02_00324117 predicted 1310
5 SASI_Hs02_00324118 predicted 943
6 SASI_Hs02_00324119 predicted 1329
7 SASI_Hs02_00324120 predicted 1257
8 SASI_Hs02_00324121 predicted 1334
9 SASI_Hs02_00324122 predicted 1312
10 SASI_Hs02_00324123 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_295200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250013 predicted 1353
2 SASI_Hs01_00250014 predicted 1068
3 SASI_Hs01_00250015 predicted 1515
4 SASI_Hs01_00250016 predicted 1392
5 SASI_Hs01_00250017 predicted 1391
6 SASI_Hs01_00250018 predicted 1345
7 SASI_Hs01_00250019 predicted 937
8 SASI_Hs01_00250020 predicted 1253
9 SASI_Hs01_00250021 predicted 1506
10 SASI_Hs01_00250022 predicted 1394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374519 predicted 236
2 SASI_Rn02_00374520 predicted 215
3 SASI_Rn02_00374521 predicted 211
4 SASI_Rn02_00374522 predicted 204
5 SASI_Rn02_00374523 predicted 251
6 SASI_Rn02_00374524 predicted 332
7 SASI_Rn02_00374525 predicted 327
8 SASI_Rn02_00374526 predicted 214
9 SASI_Rn02_00374527 predicted 216
10 SASI_Rn02_00374528 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236939 predicted 260
2 SASI_Mm01_00236940 predicted 256
3 SASI_Mm01_00236941 predicted 258
4 SASI_Mm01_00236942 predicted 215
5 SASI_Mm01_00236943 predicted 270
6 SASI_Mm01_00236944 predicted 273
7 SASI_Mm01_00236946 predicted 276
8 SASI_Mm01_00236947 predicted 253
9 SASI_Mm01_00236948 predicted 260
10 SASI_Mm02_00355577 predicted 274
11 SASI_Mm01_00236945 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204687 predicted 275
2 SASI_Mm01_00204688 predicted 249
3 SASI_Mm01_00204689 predicted 274
4 SASI_Mm01_00204690 predicted 243
5 SASI_Mm02_00355578 predicted 390
6 SASI_Mm01_00204691 predicted 243
7 SASI_Mm01_00204692 predicted 220
8 SASI_Mm01_00204693 predicted 273
9 SASI_Mm01_00204695 predicted 388
10 SASI_Mm01_00204696 predicted 273
11 SASI_Mm01_00204694 predicted 312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162878
FAM183B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 183, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162878.1-278s21c1
Sequence:CCGGGAAATTGGATGGGACCCAAATCTCGAGATTTGGGTCCCATCCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162878.1-201s21c1
Sequence:CCGGCCAAGTTCCTGAACCTCATTCCTCGAGGAATGAGGTTCAGGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162878.1-99s21c1
Sequence:CCGGAGGATGAAGTTCACCAGAATCCTCGAGGATTCTGGTGAACTTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162878.1-168s21c1
Sequence:CCGGACACGCAGTATCACGTGAATCCTCGAGGATTCACGTGATACTGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162878.1-359s21c1
Sequence:CCGGATCACTCTGTACAAGGCTAAACTCGAGTTTAGCCTTGTACAGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162878
FAM183B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 183, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162878.1-278s21c1
Sequence:CCGGGAAATTGGATGGGACCCAAATCTCGAGATTTGGGTCCCATCCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162878.1-201s21c1
Sequence:CCGGCCAAGTTCCTGAACCTCATTCCTCGAGGAATGAGGTTCAGGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162878.1-99s21c1
Sequence:CCGGAGGATGAAGTTCACCAGAATCCTCGAGGATTCTGGTGAACTTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162878.1-168s21c1
Sequence:CCGGACACGCAGTATCACGTGAATCCTCGAGGATTCACGTGATACTGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162878.1-359s21c1
Sequence:CCGGATCACTCTGTACAAGGCTAAACTCGAGTTTAGCCTTGTACAGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162878
FAM183B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 183, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162878.1-278s21c1
Sequence:CCGGGAAATTGGATGGGACCCAAATCTCGAGATTTGGGTCCCATCCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162878.1-201s21c1
Sequence:CCGGCCAAGTTCCTGAACCTCATTCCTCGAGGAATGAGGTTCAGGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162878.1-99s21c1
Sequence:CCGGAGGATGAAGTTCACCAGAATCCTCGAGGATTCTGGTGAACTTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162878.1-168s21c1
Sequence:CCGGACACGCAGTATCACGTGAATCCTCGAGGATTCACGTGATACTGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162878.1-359s21c1
Sequence:CCGGATCACTCTGTACAAGGCTAAACTCGAGTTTAGCCTTGTACAGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105282
FAM183B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 183, member B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000268421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105282.2-1408s21c1
Sequence:CCGGGGAGTCAGGCCCTGGATTTAACTCGAGTTAAATCCAGGGCCTGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105282.2-1052s21c1
Sequence:CCGGAGCTGTACCTCAAAGAGTTACCTCGAGGTAACTCTTTGAGGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105282.2-1112s21c1
Sequence:CCGGTGCGCAAGGTTCACAGGATTACTCGAGTAATCCTGTGAACCTTGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105282.2-1014s21c1
Sequence:CCGGGGTCACAGATGAGGTCCATCACTCGAGTGATGGACCTCATCTGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105282
FAM183B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 183, member B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000268421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105282.2-1408s21c1
Sequence:CCGGGGAGTCAGGCCCTGGATTTAACTCGAGTTAAATCCAGGGCCTGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105282.2-1052s21c1
Sequence:CCGGAGCTGTACCTCAAAGAGTTACCTCGAGGTAACTCTTTGAGGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105282.2-1112s21c1
Sequence:CCGGTGCGCAAGGTTCACAGGATTACTCGAGTAATCCTGTGAACCTTGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105282.2-1014s21c1
Sequence:CCGGGGTCACAGATGAGGTCCATCACTCGAGTGATGGACCTCATCTGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105282
FAM183B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 183, member B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000268421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105282.2-1408s21c1
Sequence:CCGGGGAGTCAGGCCCTGGATTTAACTCGAGTTAAATCCAGGGCCTGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105282.2-1052s21c1
Sequence:CCGGAGCTGTACCTCAAAGAGTTACCTCGAGGTAACTCTTTGAGGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105282.2-1112s21c1
Sequence:CCGGTGCGCAAGGTTCACAGGATTACTCGAGTAATCCTGTGAACCTTGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105282.2-1014s21c1
Sequence:CCGGGGTCACAGATGAGGTCCATCACTCGAGTGATGGACCTCATCTGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks