EMAIL THIS PAGE TO A FRIEND

FAM184A

family with sequence similarity 184, member A

120 Gene Product Result for
Synonyms: C6orf60
Gene ID:
Mouse(75906) family with sequence similarity 184, member A
Rat(361853) family with sequence similarity 184, member A
Zebrafish(555640) family with sequence similarity 184, member A
chicken(421727) family with sequence similarity 184, member A
domestic cat(101098460) family with sequence similarity 184, member A
cow(541122) family with sequence similarity 184, member A
dog(476274) family with sequence similarity 184, member A
domestic guinea pig(100732802) family with sequence similarity 184, member A
naked mole-rat(101697419) family with sequence similarity 184, member A
sheep(101123047) family with sequence similarity 184, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024581 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060911 MISSION® esiRNA esiRNA human FAM184A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100411 Rosetta Predictions human pricing
NM_024581 Rosetta Predictions human pricing
XM_001058676 Rosetta Predictions rat pricing
XM_342147 Rosetta Predictions rat pricing
NM_001081428 Rosetta Predictions mouse pricing
XM_991460 Rosetta Predictions mouse pricing
XM_991491 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321984 predicted 1124
2 SASI_Hs02_00321985 predicted 1098
3 SASI_Hs02_00321986 predicted 494
4 SASI_Hs02_00321987 predicted 2972
5 SASI_Hs02_00321988 predicted 1666
6 SASI_Hs02_00321989 predicted 1613
7 SASI_Hs02_00321990 predicted 3259
8 SASI_Hs02_00321991 predicted 1590
9 SASI_Hs02_00321992 predicted 538
10 SASI_Hs02_00321993 predicted 3099
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174139 predicted 1524
2 SASI_Hs02_00356907 predicted 1487
3 SASI_Hs01_00174142 predicted 885
4 SASI_Hs02_00356908 predicted 3505
5 SASI_Hs01_00174145 predicted 2052
6 SASI_Hs02_00356909 predicted 2009
7 SASI_Hs01_00174146 predicted 3800
8 SASI_Hs01_00174147 predicted 1982
9 SASI_Hs01_00174148 predicted 931
10 SASI_Hs02_00356910 predicted 3634
11 SASI_Hs01_00174140 predicted 3374
12 SASI_Hs01_00174141 predicted 3078
13 SASI_Hs01_00174143 predicted 2926
14 SASI_Hs01_00174144 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290476 predicted 2911
2 SASI_Rn02_00290477 predicted 1054
3 SASI_Rn02_00290478 predicted 265
4 SASI_Rn02_00290479 predicted 380
5 SASI_Rn02_00290480 predicted 3126
6 SASI_Rn02_00290481 predicted 1538
7 SASI_Rn02_00290482 predicted 394
8 SASI_Rn02_00290483 predicted 3110
9 SASI_Rn02_00290484 predicted 2732
10 SASI_Rn02_00290485 predicted 2494
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393814 predicted 2896
2 SASI_Rn02_00393815 predicted 1036
3 SASI_Rn02_00393816 predicted 252
4 SASI_Rn02_00393817 predicted 370
5 SASI_Rn02_00393818 predicted 3108
6 SASI_Rn02_00393819 predicted 554
7 SASI_Rn02_00393820 predicted 1516
8 SASI_Rn02_00393821 predicted 381
9 SASI_Rn02_00393822 predicted 3093
10 SASI_Rn02_00393823 predicted 2713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298281 predicted 1076
2 SASI_Mm02_00298282 predicted 1563
3 SASI_Mm02_00298283 predicted 3149
4 SASI_Mm02_00298284 predicted 2717
5 SASI_Mm02_00298285 predicted 2946
6 SASI_Mm02_00298286 predicted 420
7 SASI_Mm02_00298287 predicted 2762
8 SASI_Mm02_00298288 predicted 2934
9 SASI_Mm02_00298289 predicted 3141
10 SASI_Mm02_00298290 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224984 predicted 845
2 SASI_Mm01_00224985 predicted 817
3 SASI_Mm01_00224986 predicted 1081
4 SASI_Mm01_00224987 predicted 1042
5 SASI_Mm01_00224988 predicted 242
6 SASI_Mm01_00224989 predicted 501
7 SASI_Mm01_00224990 predicted 428
8 SASI_Mm01_00224991 predicted 582
9 SASI_Mm01_00224992 predicted 282
10 SASI_Mm01_00224993 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216917 predicted 1085
2 SASI_Mm01_00216918 predicted 1567
3 SASI_Mm01_00216919 predicted 3151
4 SASI_Mm01_00216920 predicted 2949
5 SASI_Mm01_00216921 predicted 435
6 SASI_Mm01_00216922 predicted 2768
7 SASI_Mm01_00216923 predicted 2940
8 SASI_Mm01_00216924 predicted 3142
9 SASI_Mm01_00216925 predicted 479
10 SASI_Mm01_00216926 predicted 3095
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081428
FAM184A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 184, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081428.1-3623s21c1
Sequence:CCGGCACTCTCTGAGGTACTATATTCTCGAGAATATAGTACCTCAGAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081428.1-416s21c1
Sequence:CCGGGACCGAGTTTGAAGCCTATAACTCGAGTTATAGGCTTCAAACTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081428.1-2522s21c1
Sequence:CCGGACATGCGGCTTCCATTGATTTCTCGAGAAATCAATGGAAGCCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081428.1-3042s21c1
Sequence:CCGGGAACGAGACCAGGTCATAAAGCTCGAGCTTTATGACCTGGTCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081428.1-1825s21c1
Sequence:CCGGAGACCAAGGATGCCCTATTAACTCGAGTTAATAGGGCATCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081428
FAM184A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 184, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081428.1-3623s21c1
Sequence:CCGGCACTCTCTGAGGTACTATATTCTCGAGAATATAGTACCTCAGAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081428.1-416s21c1
Sequence:CCGGGACCGAGTTTGAAGCCTATAACTCGAGTTATAGGCTTCAAACTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081428.1-2522s21c1
Sequence:CCGGACATGCGGCTTCCATTGATTTCTCGAGAAATCAATGGAAGCCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081428.1-3042s21c1
Sequence:CCGGGAACGAGACCAGGTCATAAAGCTCGAGCTTTATGACCTGGTCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081428.1-1825s21c1
Sequence:CCGGAGACCAAGGATGCCCTATTAACTCGAGTTAATAGGGCATCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081428
FAM184A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 184, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081428.1-3623s21c1
Sequence:CCGGCACTCTCTGAGGTACTATATTCTCGAGAATATAGTACCTCAGAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081428.1-416s21c1
Sequence:CCGGGACCGAGTTTGAAGCCTATAACTCGAGTTATAGGCTTCAAACTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081428.1-2522s21c1
Sequence:CCGGACATGCGGCTTCCATTGATTTCTCGAGAAATCAATGGAAGCCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081428.1-3042s21c1
Sequence:CCGGGAACGAGACCAGGTCATAAAGCTCGAGCTTTATGACCTGGTCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081428.1-1825s21c1
Sequence:CCGGAGACCAAGGATGCCCTATTAACTCGAGTTAATAGGGCATCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024581
VALIDATED
FAM184A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 184, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024581.3-1519s1c1
Sequence:CCGGGCAACTCAAATGACCCAGGAACTCGAGTTCCTGGGTCATTTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024581.3-3851s1c1
Sequence:CCGGCCTATGTCAAACACTGTGAATCTCGAGATTCACAGTGTTTGACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024581.3-2056s1c1
Sequence:CCGGGAAGGACTTATTGCTAGTCTTCTCGAGAAGACTAGCAATAAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024581.3-1405s1c1
Sequence:CCGGGCCCTATTAAGCAAGCACAAACTCGAGTTTGTGCTTGCTTAATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024581.3-3247s1c1
Sequence:CCGGGCCGCTTTACAAGTGTCATTACTCGAGTAATGACACTTGTAAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148861    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024581.3-3786s1c1
Sequence:CCGGCACAGCTCTGTATAGACTGTTCTCGAGAACAGTCTATACAGAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024581.3-2365s1c1
Sequence:CCGGCAGTTGAAAGATCGAGAGAAACTCGAGTTTCTCTCGATCTTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024581.3-651s1c1
Sequence:CCGGGCTAGACCTTAGAAGAAAGATCTCGAGATCTTTCTTCTAAGGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024581.3-1495s1c1
Sequence:CCGGGCTAGTCATATTGGAATGCTTCTCGAGAAGCATTCCAATATGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024581
VALIDATED
FAM184A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 184, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024581.3-1519s1c1
Sequence:CCGGGCAACTCAAATGACCCAGGAACTCGAGTTCCTGGGTCATTTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024581.3-3851s1c1
Sequence:CCGGCCTATGTCAAACACTGTGAATCTCGAGATTCACAGTGTTTGACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024581.3-2056s1c1
Sequence:CCGGGAAGGACTTATTGCTAGTCTTCTCGAGAAGACTAGCAATAAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024581.3-1405s1c1
Sequence:CCGGGCCCTATTAAGCAAGCACAAACTCGAGTTTGTGCTTGCTTAATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024581.3-3247s1c1
Sequence:CCGGGCCGCTTTACAAGTGTCATTACTCGAGTAATGACACTTGTAAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148861    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024581.3-3786s1c1
Sequence:CCGGCACAGCTCTGTATAGACTGTTCTCGAGAACAGTCTATACAGAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024581.3-2365s1c1
Sequence:CCGGCAGTTGAAAGATCGAGAGAAACTCGAGTTTCTCTCGATCTTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024581.3-651s1c1
Sequence:CCGGGCTAGACCTTAGAAGAAAGATCTCGAGATCTTTCTTCTAAGGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024581.3-1495s1c1
Sequence:CCGGGCTAGTCATATTGGAATGCTTCTCGAGAAGCATTCCAATATGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024581
VALIDATED
FAM184A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 184, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024581.3-1519s1c1
Sequence:CCGGGCAACTCAAATGACCCAGGAACTCGAGTTCCTGGGTCATTTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024581.3-3851s1c1
Sequence:CCGGCCTATGTCAAACACTGTGAATCTCGAGATTCACAGTGTTTGACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024581.3-2056s1c1
Sequence:CCGGGAAGGACTTATTGCTAGTCTTCTCGAGAAGACTAGCAATAAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024581.3-1405s1c1
Sequence:CCGGGCCCTATTAAGCAAGCACAAACTCGAGTTTGTGCTTGCTTAATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024581.3-3247s1c1
Sequence:CCGGGCCGCTTTACAAGTGTCATTACTCGAGTAATGACACTTGTAAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148861    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024581.3-3786s1c1
Sequence:CCGGCACAGCTCTGTATAGACTGTTCTCGAGAACAGTCTATACAGAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024581.3-2365s1c1
Sequence:CCGGCAGTTGAAAGATCGAGAGAAACTCGAGTTTCTCTCGATCTTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024581.3-651s1c1
Sequence:CCGGGCTAGACCTTAGAAGAAAGATCTCGAGATCTTTCTTCTAAGGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024581.3-1495s1c1
Sequence:CCGGGCTAGTCATATTGGAATGCTTCTCGAGAAGCATTCCAATATGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks