EMAIL THIS PAGE TO A FRIEND

FAM184B

family with sequence similarity 184, member B

78 Gene Product Result for
UniProtKB ID: Q9ULE4
Gene ID:
Mouse(58227) family with sequence similarity 184, member B
Rat(289671) family with sequence similarity 184, member B
sheep(101121264) family with sequence similarity 184, member B
naked mole-rat(101711401) family with sequence similarity 184, member B
domestic guinea pig(100717902) family with sequence similarity 184, member B
Zebrafish(557812) family with sequence similarity 184, member B
chicken(100859145) family with sequence similarity 184, member B
cow(523874) family with sequence similarity 184, member B
domestic cat(101086058) family with sequence similarity 184, member B
dog(479080) family with sequence similarity 184, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015688 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015688 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015688 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001717325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001717325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001717325 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026741 MISSION® esiRNA esiRNA targeting mouse Fam184b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717325 Rosetta Predictions human pricing
XM_039169 Rosetta Predictions human pricing
XM_940199 Rosetta Predictions human pricing
XM_001058964 Rosetta Predictions rat pricing
XM_223466 Rosetta Predictions rat pricing
NM_021416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00416508 predicted 3528
2 SASI_Hs02_00416509 predicted 2330
3 SASI_Hs02_00416510 predicted 1435
4 SASI_Hs02_00416511 predicted 1673
5 SASI_Hs02_00416512 predicted 1621
6 SASI_Hs02_00416513 predicted 3383
7 SASI_Hs02_00416514 predicted 3436
8 SASI_Hs02_00416515 predicted 3691
9 SASI_Hs02_00416516 predicted 2365
10 SASI_Hs02_00416517 predicted 2476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_039169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273004 predicted 3535
2 SASI_Hs01_00273005 predicted 2336
3 SASI_Hs01_00273006 predicted 3707
4 SASI_Hs01_00273007 predicted 1431
5 SASI_Hs01_00273008 predicted 1673
6 SASI_Hs01_00273009 predicted 3702
7 SASI_Hs01_00273010 predicted 1621
8 SASI_Hs01_00273011 predicted 3377
9 SASI_Hs01_00273012 predicted 3433
10 SASI_Hs01_00273013 predicted 3693
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_940199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484077 predicted 3533
2 SASI_Hs02_00484078 predicted 2332
3 SASI_Hs02_00484079 predicted 1429
4 SASI_Hs02_00484080 predicted 1670
5 SASI_Hs02_00484081 predicted 1624
6 SASI_Hs02_00484082 predicted 3381
7 SASI_Hs02_00484083 predicted 3429
8 SASI_Hs02_00484084 predicted 3686
9 SASI_Hs02_00484085 predicted 2370
10 SASI_Hs02_00484086 predicted 2477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291433 predicted 1311
2 SASI_Rn02_00291434 predicted 1280
3 SASI_Rn02_00291435 predicted 2937
4 SASI_Rn02_00291436 predicted 1007
5 SASI_Rn02_00291437 predicted 488
6 SASI_Rn02_00291438 predicted 473
7 SASI_Rn02_00291439 predicted 1208
8 SASI_Rn02_00291440 predicted 2995
9 SASI_Rn02_00291441 predicted 819
10 SASI_Rn02_00291442 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381397 predicted 1319
2 SASI_Rn02_00381398 predicted 1289
3 SASI_Rn02_00381399 predicted 2941
4 SASI_Rn02_00381400 predicted 1002
5 SASI_Rn02_00381401 predicted 485
6 SASI_Rn02_00381402 predicted 481
7 SASI_Rn02_00381403 predicted 1209
8 SASI_Rn02_00381404 predicted 2995
9 SASI_Rn02_00381405 predicted 815
10 SASI_Rn02_00381406 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078691 predicted 2849
2 SASI_Mm01_00078692 predicted 2697
3 SASI_Mm01_00078693 predicted 873
4 SASI_Mm01_00078694 predicted 3186
5 SASI_Mm01_00078695 predicted 3098
6 SASI_Mm01_00078696 predicted 1824
7 SASI_Mm01_00078697 predicted 2949
8 SASI_Mm02_00326051 predicted 386
9 SASI_Mm01_00078699 predicted 1435
10 SASI_Mm01_00078700 predicted 2313
11 SASI_Mm01_00078698 predicted 215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021416
FAM184B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 184, member B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021416.2-2498s1c1
Sequence:CCGGCGGAAGAGAGAAGATTTCATTCTCGAGAATGAAATCTTCTCTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021416.2-2656s1c1
Sequence:CCGGGCCTCCTATGCGAAGAACTTTCTCGAGAAAGTTCTTCGCATAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021416.3-396s1c1
Sequence:CCGGCTCAGCTCACTAAGGTTATTTCTCGAGAAATAACCTTAGTGAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021416.3-3284s1c1
Sequence:CCGGGATGAAACAAGCCAGTTATTACTCGAGTAATAACTGGCTTGTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021416.3-3284s21c1
Sequence:CCGGGATGAAACAAGCCAGTTATTACTCGAGTAATAACTGGCTTGTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021416.3-1236s21c1
Sequence:CCGGTTGGCGAGAAGTTGGCTATTGCTCGAGCAATAGCCAACTTCTCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021416.3-396s21c1
Sequence:CCGGCTCAGCTCACTAAGGTTATTTCTCGAGAAATAACCTTAGTGAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021416.3-832s21c1
Sequence:CCGGGTCTAGCCAGAGACCGGAAATCTCGAGATTTCCGGTCTCTGGCTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021416.3-697s21c1
Sequence:CCGGTGAACGAGTCCTGATACTTTCCTCGAGGAAAGTATCAGGACTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021416
FAM184B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 184, member B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021416.2-2498s1c1
Sequence:CCGGCGGAAGAGAGAAGATTTCATTCTCGAGAATGAAATCTTCTCTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021416.2-2656s1c1
Sequence:CCGGGCCTCCTATGCGAAGAACTTTCTCGAGAAAGTTCTTCGCATAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021416.3-396s1c1
Sequence:CCGGCTCAGCTCACTAAGGTTATTTCTCGAGAAATAACCTTAGTGAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021416.3-3284s1c1
Sequence:CCGGGATGAAACAAGCCAGTTATTACTCGAGTAATAACTGGCTTGTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021416.3-3284s21c1
Sequence:CCGGGATGAAACAAGCCAGTTATTACTCGAGTAATAACTGGCTTGTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021416.3-1236s21c1
Sequence:CCGGTTGGCGAGAAGTTGGCTATTGCTCGAGCAATAGCCAACTTCTCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021416.3-396s21c1
Sequence:CCGGCTCAGCTCACTAAGGTTATTTCTCGAGAAATAACCTTAGTGAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021416.3-832s21c1
Sequence:CCGGGTCTAGCCAGAGACCGGAAATCTCGAGATTTCCGGTCTCTGGCTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021416.3-697s21c1
Sequence:CCGGTGAACGAGTCCTGATACTTTCCTCGAGGAAAGTATCAGGACTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021416
FAM184B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 184, member B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021416.2-2498s1c1
Sequence:CCGGCGGAAGAGAGAAGATTTCATTCTCGAGAATGAAATCTTCTCTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021416.2-2656s1c1
Sequence:CCGGGCCTCCTATGCGAAGAACTTTCTCGAGAAAGTTCTTCGCATAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021416.3-396s1c1
Sequence:CCGGCTCAGCTCACTAAGGTTATTTCTCGAGAAATAACCTTAGTGAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021416.3-3284s1c1
Sequence:CCGGGATGAAACAAGCCAGTTATTACTCGAGTAATAACTGGCTTGTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021416.3-3284s21c1
Sequence:CCGGGATGAAACAAGCCAGTTATTACTCGAGTAATAACTGGCTTGTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021416.3-1236s21c1
Sequence:CCGGTTGGCGAGAAGTTGGCTATTGCTCGAGCAATAGCCAACTTCTCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021416.3-396s21c1
Sequence:CCGGCTCAGCTCACTAAGGTTATTTCTCGAGAAATAACCTTAGTGAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021416.3-832s21c1
Sequence:CCGGGTCTAGCCAGAGACCGGAAATCTCGAGATTTCCGGTCTCTGGCTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021416.3-697s21c1
Sequence:CCGGTGAACGAGTCCTGATACTTTCCTCGAGGAAAGTATCAGGACTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015688
FAM184B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 184, member B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000377601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015688.1-2007s21c1
Sequence:CCGGGCAAAGCCAGAAGGCCAAATTCTCGAGAATTTGGCCTTCTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015688.1-3454s21c1
Sequence:CCGGCGATTGAAGGAATGAACTAACCTCGAGGTTAGTTCATTCCTTCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015688.1-3528s21c1
Sequence:CCGGTTTGGCGTTAACACTTCATACCTCGAGGTATGAAGTGTTAACGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015688.1-3184s21c1
Sequence:CCGGGATCTGAGTTCCAGGATTAATCTCGAGATTAATCCTGGAACTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015688
FAM184B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 184, member B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000377601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015688.1-2007s21c1
Sequence:CCGGGCAAAGCCAGAAGGCCAAATTCTCGAGAATTTGGCCTTCTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015688.1-3454s21c1
Sequence:CCGGCGATTGAAGGAATGAACTAACCTCGAGGTTAGTTCATTCCTTCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015688.1-3528s21c1
Sequence:CCGGTTTGGCGTTAACACTTCATACCTCGAGGTATGAAGTGTTAACGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015688.1-3184s21c1
Sequence:CCGGGATCTGAGTTCCAGGATTAATCTCGAGATTAATCCTGGAACTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015688
FAM184B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 184, member B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000377601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015688.1-2007s21c1
Sequence:CCGGGCAAAGCCAGAAGGCCAAATTCTCGAGAATTTGGCCTTCTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015688.1-3454s21c1
Sequence:CCGGCGATTGAAGGAATGAACTAACCTCGAGGTTAGTTCATTCCTTCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015688.1-3528s21c1
Sequence:CCGGTTTGGCGTTAACACTTCATACCTCGAGGTATGAAGTGTTAACGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015688.1-3184s21c1
Sequence:CCGGGATCTGAGTTCCAGGATTAATCTCGAGATTAATCCTGGAACTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001717325
FAM184B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 184, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001717325.1-5524s21c1
Sequence:CCGGACTGTCAAACTTACGTATTAACTCGAGTTAATACGTAAGTTTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717325.1-1424s21c1
Sequence:CCGGAGCACAGAGGCCGCAAGATAACTCGAGTTATCTTGCGGCCTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717325.1-3447s21c1
Sequence:CCGGCAATCCTCACCCGGGATATTTCTCGAGAAATATCCCGGGTGAGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717325.1-1810s21c1
Sequence:CCGGTATGAAGAAGACCTTCGTAAACTCGAGTTTACGAAGGTCTTCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717325.1-1629s21c1
Sequence:CCGGCATGAAGACTGAGTTAGTTTCCTCGAGGAAACTAACTCAGTCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001717325
FAM184B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 184, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001717325.1-5524s21c1
Sequence:CCGGACTGTCAAACTTACGTATTAACTCGAGTTAATACGTAAGTTTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717325.1-1424s21c1
Sequence:CCGGAGCACAGAGGCCGCAAGATAACTCGAGTTATCTTGCGGCCTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717325.1-3447s21c1
Sequence:CCGGCAATCCTCACCCGGGATATTTCTCGAGAAATATCCCGGGTGAGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717325.1-1810s21c1
Sequence:CCGGTATGAAGAAGACCTTCGTAAACTCGAGTTTACGAAGGTCTTCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717325.1-1629s21c1
Sequence:CCGGCATGAAGACTGAGTTAGTTTCCTCGAGGAAACTAACTCAGTCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001717325
FAM184B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 184, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001717325.1-5524s21c1
Sequence:CCGGACTGTCAAACTTACGTATTAACTCGAGTTAATACGTAAGTTTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717325.1-1424s21c1
Sequence:CCGGAGCACAGAGGCCGCAAGATAACTCGAGTTATCTTGCGGCCTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717325.1-3447s21c1
Sequence:CCGGCAATCCTCACCCGGGATATTTCTCGAGAAATATCCCGGGTGAGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717325.1-1810s21c1
Sequence:CCGGTATGAAGAAGACCTTCGTAAACTCGAGTTTACGAAGGTCTTCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717325.1-1629s21c1
Sequence:CCGGCATGAAGACTGAGTTAGTTTCCTCGAGGAAACTAACTCAGTCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks