EMAIL THIS PAGE TO A FRIEND

FAM185A

family with sequence similarity 185, member A

117 Gene Product Result for
UniProtKB ID: Q8N0U4, A8MUR7, B4DQD3, C9IZ91
Gene ID:
Mouse(330050) family with sequence similarity 185, member A
Rat(499979) family with sequence similarity 185, member A
chicken(417722) family with sequence similarity 185, member A
domestic cat(101087909) family with sequence similarity 185, member A
cow(531996) family with sequence similarity 185, member A
domestic guinea pig(100725029) family with sequence similarity 185, member A
naked mole-rat(101725605) family with sequence similarity 185, member A
sheep(101103470) family with sequence similarity 185, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_147194 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147194 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147194 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147194 Rosetta Predictions human pricing
XR_041062 Rosetta Predictions human pricing
XR_041063 Rosetta Predictions human pricing
XR_041064 Rosetta Predictions human pricing
NM_001128188 Rosetta Predictions rat pricing
NM_177869 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070793 predicted 1171
2 SASI_Hs01_00070794 predicted 827
3 SASI_Hs01_00070795 predicted 1076
4 SASI_Hs01_00070796 predicted 710
5 SASI_Hs01_00070797 predicted 1124
6 SASI_Hs01_00070798 predicted 675
7 SASI_Hs01_00070799 predicted 804
8 SASI_Hs01_00070800 predicted 1029
9 SASI_Hs01_00070801 predicted 1036
10 SASI_Hs01_00070802 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524341 predicted 1200
2 SASI_Hs02_00524342 predicted 1278
3 SASI_Hs02_00524343 predicted 726
4 SASI_Hs02_00524344 predicted 1109
5 SASI_Hs02_00524345 predicted 1272
6 SASI_Hs02_00524346 predicted 1034
7 SASI_Hs02_00524347 predicted 1151
8 SASI_Hs02_00524348 predicted 1266
9 SASI_Hs02_00524349 predicted 736
10 SASI_Hs02_00524350 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524351 predicted 1203
2 SASI_Hs02_00524352 predicted 1035
3 SASI_Hs02_00524353 predicted 1266
4 SASI_Hs02_00524354 predicted 1107
5 SASI_Hs02_00524355 predicted 740
6 SASI_Hs02_00524356 predicted 1158
7 SASI_Hs02_00524357 predicted 837
8 SASI_Hs02_00524358 predicted 1195
9 SASI_Hs02_00524359 predicted 706
10 SASI_Hs02_00524360 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524361 predicted 1203
2 SASI_Hs02_00524362 predicted 1034
3 SASI_Hs02_00524363 predicted 1272
4 SASI_Hs02_00524364 predicted 1105
5 SASI_Hs02_00524365 predicted 737
6 SASI_Hs02_00524366 predicted 1151
7 SASI_Hs02_00524367 predicted 836
8 SASI_Hs02_00524368 predicted 1193
9 SASI_Hs02_00524369 predicted 704
10 SASI_Hs02_00524370 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255060 predicted 1022
2 SASI_Rn02_00255061 predicted 897
3 SASI_Rn02_00255062 predicted 1290
4 SASI_Rn02_00255063 predicted 1214
5 SASI_Rn02_00255064 predicted 626
6 SASI_Rn02_00255065 predicted 755
7 SASI_Rn02_00255066 predicted 1202
8 SASI_Rn02_00255067 predicted 694
9 SASI_Rn02_00255068 predicted 1300
10 SASI_Rn02_00255069 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158603 predicted 1008
2 SASI_Mm01_00158604 predicted 830
3 SASI_Mm01_00158605 predicted 888
4 SASI_Mm01_00158608 predicted 1247
5 SASI_Mm02_00348355 predicted 1338
6 SASI_Mm01_00158609 predicted 1088
7 SASI_Mm01_00158610 predicted 987
8 SASI_Mm01_00158611 predicted 940
9 SASI_Mm01_00158612 predicted 1215
10 SASI_Mm02_00348356 predicted 663
11 SASI_Mm01_00158606 predicted 1052
12 SASI_Mm01_00158607 predicted 1091
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177869
VALIDATED
FAM185A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 185, member A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177869.4-1010s21c1
Sequence:CCGGGTTCATGGAAATATCATCTTACTCGAGTAAGATGATATTTCCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177869.4-1177s21c1
Sequence:CCGGATCTTCTCTACGAGCTTATTTCTCGAGAAATAAGCTCGTAGAGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177869.4-937s21c1
Sequence:CCGGGCTTCAAGCCAAGTATCTTTACTCGAGTAAAGATACTTGGCTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177869.4-1557s21c1
Sequence:CCGGGTTGTTCTGTTCCAGATTATACTCGAGTATAATCTGGAACAGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177869.4-1309s21c1
Sequence:CCGGCAAACACGAGAGATGGATAAACTCGAGTTTATCCATCTCTCGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177869.2-486s1c1
Sequence:CCGGCAAGTATGATGCTGATCGGCACTCGAGTGCCGATCAGCATCATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177869.2-719s1c1
Sequence:CCGGGCGATGTGATCTGTTGTGGAACTCGAGTTCCACAACAGATCACATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177869.2-621s1c1
Sequence:CCGGGAATATTGAATGTGATAGCTGCTCGAGCAGCTATCACATTCAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177869.2-566s1c1
Sequence:CCGGCCGTCAAATTTGATTTGAGTACTCGAGTACTCAAATCAAATTTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177869.4-1143s21c1
Sequence:CCGGCAACAGAAGAAGGTTCTATTGCTCGAGCAATAGAACCTTCTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177869
VALIDATED
FAM185A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 185, member A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177869.4-1010s21c1
Sequence:CCGGGTTCATGGAAATATCATCTTACTCGAGTAAGATGATATTTCCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177869.4-1177s21c1
Sequence:CCGGATCTTCTCTACGAGCTTATTTCTCGAGAAATAAGCTCGTAGAGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177869.4-937s21c1
Sequence:CCGGGCTTCAAGCCAAGTATCTTTACTCGAGTAAAGATACTTGGCTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177869.4-1557s21c1
Sequence:CCGGGTTGTTCTGTTCCAGATTATACTCGAGTATAATCTGGAACAGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177869.4-1309s21c1
Sequence:CCGGCAAACACGAGAGATGGATAAACTCGAGTTTATCCATCTCTCGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177869.2-486s1c1
Sequence:CCGGCAAGTATGATGCTGATCGGCACTCGAGTGCCGATCAGCATCATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177869.2-719s1c1
Sequence:CCGGGCGATGTGATCTGTTGTGGAACTCGAGTTCCACAACAGATCACATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177869.2-621s1c1
Sequence:CCGGGAATATTGAATGTGATAGCTGCTCGAGCAGCTATCACATTCAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177869.2-566s1c1
Sequence:CCGGCCGTCAAATTTGATTTGAGTACTCGAGTACTCAAATCAAATTTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177869.4-1143s21c1
Sequence:CCGGCAACAGAAGAAGGTTCTATTGCTCGAGCAATAGAACCTTCTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177869
VALIDATED
FAM185A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 185, member A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177869.4-1010s21c1
Sequence:CCGGGTTCATGGAAATATCATCTTACTCGAGTAAGATGATATTTCCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177869.4-1177s21c1
Sequence:CCGGATCTTCTCTACGAGCTTATTTCTCGAGAAATAAGCTCGTAGAGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177869.4-937s21c1
Sequence:CCGGGCTTCAAGCCAAGTATCTTTACTCGAGTAAAGATACTTGGCTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177869.4-1557s21c1
Sequence:CCGGGTTGTTCTGTTCCAGATTATACTCGAGTATAATCTGGAACAGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177869.4-1309s21c1
Sequence:CCGGCAAACACGAGAGATGGATAAACTCGAGTTTATCCATCTCTCGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177869.2-486s1c1
Sequence:CCGGCAAGTATGATGCTGATCGGCACTCGAGTGCCGATCAGCATCATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177869.2-719s1c1
Sequence:CCGGGCGATGTGATCTGTTGTGGAACTCGAGTTCCACAACAGATCACATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177869.2-621s1c1
Sequence:CCGGGAATATTGAATGTGATAGCTGCTCGAGCAGCTATCACATTCAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177869.2-566s1c1
Sequence:CCGGCCGTCAAATTTGATTTGAGTACTCGAGTACTCAAATCAAATTTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177869.4-1143s21c1
Sequence:CCGGCAACAGAAGAAGGTTCTATTGCTCGAGCAATAGAACCTTCTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147194
FAM185A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 185, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166552    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-2056s1c1
Sequence:CCGGCCCACTCAAGGAAAGGAGATTCTCGAGAATCTCCTTTCCTTGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163185    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-1886s1c1
Sequence:CCGGGCTGAGTTCTTCTCATGCTTTCTCGAGAAAGCATGAGAAGAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147194.1-625s1c1
Sequence:CCGGGCCATTGTGTCTGATACTATCCTCGAGGATAGTATCAGACACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159862    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-936s1c1
Sequence:CCGGGCCAAGTATCTTTATACAGAACTCGAGTTCTGTATAAAGATACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164171    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-2057s1c1
Sequence:CCGGCCACTCAAGGAAAGGAGATTACTCGAGTAATCTCCTTTCCTTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158865    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-1902s1c1
Sequence:CCGGGCTTTGAATATCTGACTTCTTCTCGAGAAGAAGTCAGATATTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164287    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-1167s1c1
Sequence:CCGGCCATCTTCACTTCAAGCTCATCTCGAGATGAGCTTGAAGTGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147194.1-619s1c1
Sequence:CCGGGAGATGGCCATTGTGTCTGATCTCGAGATCAGACACAATGGCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147194.1-621s1c1
Sequence:CCGGGATGGCCATTGTGTCTGATACCTCGAGGTATCAGACACAATGGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147194
FAM185A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 185, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166552    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-2056s1c1
Sequence:CCGGCCCACTCAAGGAAAGGAGATTCTCGAGAATCTCCTTTCCTTGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163185    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-1886s1c1
Sequence:CCGGGCTGAGTTCTTCTCATGCTTTCTCGAGAAAGCATGAGAAGAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147194.1-625s1c1
Sequence:CCGGGCCATTGTGTCTGATACTATCCTCGAGGATAGTATCAGACACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159862    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-936s1c1
Sequence:CCGGGCCAAGTATCTTTATACAGAACTCGAGTTCTGTATAAAGATACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164171    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-2057s1c1
Sequence:CCGGCCACTCAAGGAAAGGAGATTACTCGAGTAATCTCCTTTCCTTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158865    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-1902s1c1
Sequence:CCGGGCTTTGAATATCTGACTTCTTCTCGAGAAGAAGTCAGATATTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164287    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-1167s1c1
Sequence:CCGGCCATCTTCACTTCAAGCTCATCTCGAGATGAGCTTGAAGTGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147194.1-619s1c1
Sequence:CCGGGAGATGGCCATTGTGTCTGATCTCGAGATCAGACACAATGGCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147194.1-621s1c1
Sequence:CCGGGATGGCCATTGTGTCTGATACCTCGAGGTATCAGACACAATGGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147194
FAM185A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 185, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166552    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-2056s1c1
Sequence:CCGGCCCACTCAAGGAAAGGAGATTCTCGAGAATCTCCTTTCCTTGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163185    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-1886s1c1
Sequence:CCGGGCTGAGTTCTTCTCATGCTTTCTCGAGAAAGCATGAGAAGAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147194.1-625s1c1
Sequence:CCGGGCCATTGTGTCTGATACTATCCTCGAGGATAGTATCAGACACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159862    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-936s1c1
Sequence:CCGGGCCAAGTATCTTTATACAGAACTCGAGTTCTGTATAAAGATACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164171    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-2057s1c1
Sequence:CCGGCCACTCAAGGAAAGGAGATTACTCGAGTAATCTCCTTTCCTTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158865    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-1902s1c1
Sequence:CCGGGCTTTGAATATCTGACTTCTTCTCGAGAAGAAGTCAGATATTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164287    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147194.1-1167s1c1
Sequence:CCGGCCATCTTCACTTCAAGCTCATCTCGAGATGAGCTTGAAGTGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147194.1-619s1c1
Sequence:CCGGGAGATGGCCATTGTGTCTGATCTCGAGATCAGACACAATGGCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147194.1-621s1c1
Sequence:CCGGGATGGCCATTGTGTCTGATACCTCGAGGTATCAGACACAATGGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks