EMAIL THIS PAGE TO A FRIEND

FAM186A

family with sequence similarity 186, member A

UniProtKB ID: A6NE01
Gene ID:
Mouse(380973) family with sequence similarity 186, member A
Rat(684999) family with sequence similarity 186, member A
cow(782074) family with sequence similarity 186, member A
domestic cat(101093949) family with sequence similarity 186, member A
dog(100684991) family with sequence similarity 186, member A
sheep(101117409) family with sequence similarity 186, member A
naked mole-rat(101706214) family with sequence similarity 186, member A
domestic guinea pig(100712859) family with sequence similarity 186, member A
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145475 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU222961 MISSION® esiRNA esiRNA targeting human FAM186A human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714910 Rosetta Predictions human pricing
XM_001718353 Rosetta Predictions human pricing
XM_926818 Rosetta Predictions human pricing
XM_937469 Rosetta Predictions human pricing
XM_001061851 Rosetta Predictions rat pricing
XM_354882 Rosetta Predictions mouse pricing
XM_912729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00400185 predicted 2629
2 SASI_Hs02_00400186 predicted 2029
3 SASI_Hs02_00400187 predicted 6312
4 SASI_Hs02_00400188 predicted 249
5 SASI_Hs02_00400189 predicted 6517
6 SASI_Hs02_00400190 predicted 2964
7 SASI_Hs02_00400191 predicted 6048
8 SASI_Hs02_00400192 predicted 336
9 SASI_Hs02_00400193 predicted 1040
10 SASI_Hs02_00400194 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00423282 predicted 2623
2 SASI_Hs02_00423283 predicted 2024
3 SASI_Hs02_00423284 predicted 6391
4 SASI_Hs02_00423285 predicted 1234
5 SASI_Hs02_00423286 predicted 248
6 SASI_Hs02_00423287 predicted 2963
7 SASI_Hs02_00423288 predicted 6123
8 SASI_Hs02_00423289 predicted 330
9 SASI_Hs02_00423290 predicted 2039
10 SASI_Hs02_00423291 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300381 predicted 2630
2 SASI_Hs01_00300382 predicted 2616
3 SASI_Hs01_00300383 predicted 2514
4 SASI_Hs01_00300384 predicted 2676
5 SASI_Hs01_00300385 predicted 2357
6 SASI_Hs01_00300386 predicted 2657
7 SASI_Hs01_00300387 predicted 4117
8 SASI_Hs01_00300388 predicted 2599
9 SASI_Hs01_00300389 predicted 2547
10 SASI_Hs01_00300390 predicted 2595
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482616 predicted 2628
2 SASI_Hs02_00482617 predicted 2023
3 SASI_Hs02_00482618 predicted 6385
4 SASI_Hs02_00482619 predicted 6607
5 SASI_Hs02_00482620 predicted 246
6 SASI_Hs02_00482621 predicted 6588
7 SASI_Hs02_00482622 predicted 2959
8 SASI_Hs02_00482623 predicted 6127
9 SASI_Hs02_00482624 predicted 336
10 SASI_Hs02_00482625 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301509 predicted 414
2 SASI_Rn02_00301510 predicted 658
3 SASI_Rn02_00301511 predicted 610
4 SASI_Rn02_00301512 predicted 248
5 SASI_Rn02_00301513 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_354882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230224 predicted 2970
2 SASI_Mm01_00230225 predicted 3290
3 SASI_Mm01_00230226 predicted 3034
4 SASI_Mm01_00230227 predicted 3151
5 SASI_Mm01_00230228 predicted 1311
6 SASI_Mm01_00230229 predicted 1462
7 SASI_Mm01_00230230 predicted 2160
8 SASI_Mm01_00230231 predicted 3338
9 SASI_Mm01_00230232 predicted 2842
10 SASI_Mm01_00230233 predicted 6352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437283 predicted 195
2 SASI_Mm02_00437284 predicted 2966
3 SASI_Mm02_00437285 predicted 593
4 SASI_Mm02_00437286 predicted 525
5 SASI_Mm02_00437287 predicted 3291
6 SASI_Mm02_00437288 predicted 1311
7 SASI_Mm02_00437289 predicted 461
8 SASI_Mm02_00437290 predicted 349
9 SASI_Mm02_00437291 predicted 3342
10 SASI_Mm02_00437292 predicted 280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145475
FAM186A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 186, member A
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000430598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145475.1-2483s21c1
Sequence:CCGGAGAGCACAGATCCAGTAATTACTCGAGTAATTACTGGATCTGTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145475.1-618s21c1
Sequence:CCGGGTTGTTACCGGACACGTTAAACTCGAGTTTAACGTGTCCGGTAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145475.1-2226s21c1
Sequence:CCGGTCCGAAGGAAGAGGAGTTATTCTCGAGAATAACTCCTCTTCCTTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145475
FAM186A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 186, member A
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000430598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145475.1-2483s21c1
Sequence:CCGGAGAGCACAGATCCAGTAATTACTCGAGTAATTACTGGATCTGTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145475.1-618s21c1
Sequence:CCGGGTTGTTACCGGACACGTTAAACTCGAGTTTAACGTGTCCGGTAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145475.1-2226s21c1
Sequence:CCGGTCCGAAGGAAGAGGAGTTATTCTCGAGAATAACTCCTCTTCCTTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145475
FAM186A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 186, member A
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000430598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145475.1-2483s21c1
Sequence:CCGGAGAGCACAGATCCAGTAATTACTCGAGTAATTACTGGATCTGTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145475.1-618s21c1
Sequence:CCGGGTTGTTACCGGACACGTTAAACTCGAGTTTAACGTGTCCGGTAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145475.1-2226s21c1
Sequence:CCGGTCCGAAGGAAGAGGAGTTATTCTCGAGAATAACTCCTCTTCCTTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks