EMAIL THIS PAGE TO A FRIEND

FAM186B

family with sequence similarity 186, member B

57 Gene Product Result for
Synonyms: C12orf25
UniProtKB ID: Q8IYM0, Q8TCP7, Q9H0L3
Gene ID:
Human(84070) Summary: This gene product is a member of the FAM186 family, however, its exact function is not known. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(545136) family with sequence similarity 186, member B
Rat(500931) family with sequence similarity 186, member B
domestic guinea pig(100724683) family with sequence similarity 186, member B
naked mole-rat(101711497) family with sequence similarity 186, member B
sheep(101118178) family with sequence similarity 186, member B
cow(505861) family with sequence similarity 186, member B
domestic cat(101092196) family with sequence similarity 186, member B
dog(608771) family with sequence similarity 186, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081254 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081254 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081254 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032130 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032130 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032130 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007191 MISSION® esiRNA esiRNA targeting human FAM186B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032130 Rosetta Predictions human pricing
NM_001134633 Rosetta Predictions rat pricing
NM_001081254 Rosetta Predictions mouse pricing
XM_619361 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157671 predicted 1346
2 SASI_Hs01_00157672 predicted 1446
3 SASI_Hs01_00157673 predicted 746
4 SASI_Hs01_00157675 predicted 2263
5 SASI_Hs01_00157676 predicted 2274
6 SASI_Hs01_00157677 predicted 675
7 SASI_Hs01_00157678 predicted 493
8 SASI_Hs01_00157679 predicted 1053
9 SASI_Hs01_00157680 predicted 1922
10 SASI_Hs02_00359352 predicted 2224
11 SASI_Hs01_00157674 predicted 1154
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257809 predicted 762
2 SASI_Rn02_00257810 predicted 2127
3 SASI_Rn02_00257811 predicted 2042
4 SASI_Rn02_00257812 predicted 295
5 SASI_Rn02_00257813 predicted 635
6 SASI_Rn02_00257814 predicted 393
7 SASI_Rn02_00257815 predicted 2275
8 SASI_Rn02_00257816 predicted 2289
9 SASI_Rn02_00257817 predicted 1055
10 SASI_Rn02_00257818 predicted 2288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296677 predicted 816
2 SASI_Mm02_00296678 predicted 257
3 SASI_Mm02_00296679 predicted 2213
4 SASI_Mm02_00296680 predicted 2058
5 SASI_Mm02_00296681 predicted 635
6 SASI_Mm02_00296682 predicted 2300
7 SASI_Mm02_00296683 predicted 1015
8 SASI_Mm02_00296684 predicted 1754
9 SASI_Mm02_00296685 predicted 281
10 SASI_Mm02_00296686 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250585 predicted 827
2 SASI_Mm01_00250586 predicted 253
3 SASI_Mm01_00250587 predicted 2224
4 SASI_Mm01_00250588 predicted 2064
5 SASI_Mm01_00250589 predicted 632
6 SASI_Mm01_00250590 predicted 2304
7 SASI_Mm01_00250591 predicted 1014
8 SASI_Mm01_00250592 predicted 284
9 SASI_Mm01_00250593 predicted 669
10 SASI_Mm01_00250594 predicted 2309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081254
FAM186B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 186, member B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000284273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081254.1-176s21c1
Sequence:CCGGCACATCAGTGAAGGCTATTATCTCGAGATAATAGCCTTCACTGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081254.1-3007s21c1
Sequence:CCGGTGCACAGCGGCTTGTTCTAATCTCGAGATTAGAACAAGCCGCTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081254.1-2263s21c1
Sequence:CCGGTCCGACTAGAAATGATCAAACCTCGAGGTTTGATCATTTCTAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081254.1-223s21c1
Sequence:CCGGTTCGGACTCAGGAGGATATTTCTCGAGAAATATCCTCCTGAGTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081254
FAM186B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 186, member B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000284273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081254.1-176s21c1
Sequence:CCGGCACATCAGTGAAGGCTATTATCTCGAGATAATAGCCTTCACTGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081254.1-3007s21c1
Sequence:CCGGTGCACAGCGGCTTGTTCTAATCTCGAGATTAGAACAAGCCGCTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081254.1-2263s21c1
Sequence:CCGGTCCGACTAGAAATGATCAAACCTCGAGGTTTGATCATTTCTAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081254.1-223s21c1
Sequence:CCGGTTCGGACTCAGGAGGATATTTCTCGAGAAATATCCTCCTGAGTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081254
FAM186B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 186, member B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000284273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081254.1-176s21c1
Sequence:CCGGCACATCAGTGAAGGCTATTATCTCGAGATAATAGCCTTCACTGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081254.1-3007s21c1
Sequence:CCGGTGCACAGCGGCTTGTTCTAATCTCGAGATTAGAACAAGCCGCTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081254.1-2263s21c1
Sequence:CCGGTCCGACTAGAAATGATCAAACCTCGAGGTTTGATCATTTCTAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081254.1-223s21c1
Sequence:CCGGTTCGGACTCAGGAGGATATTTCTCGAGAAATATCCTCCTGAGTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032130
FAM186B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 186, member B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032130.1-1923s1c1
Sequence:CCGGCTATGAGTTCAGTGGAGTTTACTCGAGTAAACTCCACTGAACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032130.1-2270s1c1
Sequence:CCGGGAAGCGATCAACCATGTACAACTCGAGTTGTACATGGTTGATCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032130.1-2267s1c1
Sequence:CCGGCAAGAAGCGATCAACCATGTACTCGAGTACATGGTTGATCGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032130.1-1808s1c1
Sequence:CCGGGCAGAGCTATCATTAGTGCCTCTCGAGAGGCACTAATGATAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032130.1-1394s1c1
Sequence:CCGGGCAGAAAGCTTAGGCCACAAACTCGAGTTTGTGGCCTAAGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032130.1-1349s1c1
Sequence:CCGGCCCTTAGTAGATCGCAGGTTTCTCGAGAAACCTGCGATCTACTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032130.1-2215s1c1
Sequence:CCGGGCAGTACCTGTGCCATAAGTACTCGAGTACTTATGGCACAGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032130.1-697s1c1
Sequence:CCGGCCAGCATACCATGAACACGAACTCGAGTTCGTGTTCATGGTATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032130.1-1135s1c1
Sequence:CCGGCCCAAGGAAAGAAACAGTCATCTCGAGATGACTGTTTCTTTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032130.1-251s1c1
Sequence:CCGGCAGGAAGAATTAGGATATGATCTCGAGATCATATCCTAATTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032130
FAM186B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 186, member B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032130.1-1923s1c1
Sequence:CCGGCTATGAGTTCAGTGGAGTTTACTCGAGTAAACTCCACTGAACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032130.1-2270s1c1
Sequence:CCGGGAAGCGATCAACCATGTACAACTCGAGTTGTACATGGTTGATCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032130.1-2267s1c1
Sequence:CCGGCAAGAAGCGATCAACCATGTACTCGAGTACATGGTTGATCGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032130.1-1808s1c1
Sequence:CCGGGCAGAGCTATCATTAGTGCCTCTCGAGAGGCACTAATGATAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032130.1-1394s1c1
Sequence:CCGGGCAGAAAGCTTAGGCCACAAACTCGAGTTTGTGGCCTAAGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032130.1-1349s1c1
Sequence:CCGGCCCTTAGTAGATCGCAGGTTTCTCGAGAAACCTGCGATCTACTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032130.1-2215s1c1
Sequence:CCGGGCAGTACCTGTGCCATAAGTACTCGAGTACTTATGGCACAGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032130.1-697s1c1
Sequence:CCGGCCAGCATACCATGAACACGAACTCGAGTTCGTGTTCATGGTATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032130.1-1135s1c1
Sequence:CCGGCCCAAGGAAAGAAACAGTCATCTCGAGATGACTGTTTCTTTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032130.1-251s1c1
Sequence:CCGGCAGGAAGAATTAGGATATGATCTCGAGATCATATCCTAATTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032130
FAM186B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 186, member B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032130.1-1923s1c1
Sequence:CCGGCTATGAGTTCAGTGGAGTTTACTCGAGTAAACTCCACTGAACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032130.1-2270s1c1
Sequence:CCGGGAAGCGATCAACCATGTACAACTCGAGTTGTACATGGTTGATCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032130.1-2267s1c1
Sequence:CCGGCAAGAAGCGATCAACCATGTACTCGAGTACATGGTTGATCGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032130.1-1808s1c1
Sequence:CCGGGCAGAGCTATCATTAGTGCCTCTCGAGAGGCACTAATGATAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032130.1-1394s1c1
Sequence:CCGGGCAGAAAGCTTAGGCCACAAACTCGAGTTTGTGGCCTAAGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032130.1-1349s1c1
Sequence:CCGGCCCTTAGTAGATCGCAGGTTTCTCGAGAAACCTGCGATCTACTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032130.1-2215s1c1
Sequence:CCGGGCAGTACCTGTGCCATAAGTACTCGAGTACTTATGGCACAGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032130.1-697s1c1
Sequence:CCGGCCAGCATACCATGAACACGAACTCGAGTTCGTGTTCATGGTATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032130.1-1135s1c1
Sequence:CCGGCCCAAGGAAAGAAACAGTCATCTCGAGATGACTGTTTCTTTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032130.1-251s1c1
Sequence:CCGGCAGGAAGAATTAGGATATGATCTCGAGATCATATCCTAATTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks