EMAIL THIS PAGE TO A FRIEND

FAM187B

family with sequence similarity 187, member B

41 Gene Product Result for
Synonyms: TMEM162
UniProtKB ID: Q17R55, Q8N7G6
Gene ID:
Mouse(76415) family with sequence similarity 187, member B
Rat(689048) family with sequence similarity 187, member B
dog(612665) family with sequence similarity 187, member B
cow(618193) family with sequence similarity 187, member B
domestic cat(101088130) family with sequence similarity 187, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA014687 Anti-FAM187B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152481 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175240 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175240 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175240 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156261 MISSION® esiRNA esiRNA human FAM187B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152481 Rosetta Predictions human pricing
XM_001069328 Rosetta Predictions rat pricing
NM_175240 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135804 predicted 338
2 SASI_Hs01_00135805 predicted 376
3 SASI_Hs01_00135806 predicted 316
4 SASI_Hs02_00366257 predicted 438
5 SASI_Hs01_00135807 predicted 235
6 SASI_Hs01_00135808 predicted 655
7 SASI_Hs01_00135809 predicted 573
8 SASI_Hs01_00135810 predicted 761
9 SASI_Hs01_00135811 predicted 723
10 SASI_Hs01_00135812 predicted 537
11 SASI_Hs01_00135813 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069328 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327641 predicted 399
2 SASI_Rn02_00327642 predicted 296
3 SASI_Rn02_00327643 predicted 294
4 SASI_Rn02_00327644 predicted 299
5 SASI_Rn02_00327645 predicted 337
6 SASI_Rn02_00327646 predicted 228
7 SASI_Rn02_00327647 predicted 266
8 SASI_Rn02_00327648 predicted 282
9 SASI_Rn02_00327649 predicted 378
10 SASI_Rn02_00327650 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102015 predicted 649
2 SASI_Mm01_00102016 predicted 311
3 SASI_Mm01_00102017 predicted 325
4 SASI_Mm01_00102018 predicted 590
5 SASI_Mm01_00102019 predicted 902
6 SASI_Mm01_00102020 predicted 566
7 SASI_Mm01_00102021 predicted 928
8 SASI_Mm01_00102023 predicted 355
9 SASI_Mm02_00345926 predicted 928
10 SASI_Mm02_00345927 predicted 677
11 SASI_Mm01_00102014 predicted 982
12 SASI_Mm01_00102022 predicted 492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152481
FAM187B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 187, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000135496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152481.1-657s1c1
Sequence:CCGGGTGCACCAATAACACACAGTTCTCGAGAACTGTGTGTTATTGGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152481.1-349s1c1
Sequence:CCGGCAAGTGGTGCAGTATGAAATTCTCGAGAATTTCATACTGCACCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152481.1-355s1c1
Sequence:CCGGGTGCAGTATGAAATTGACTTTCTCGAGAAAGTCAATTTCATACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152481.1-155s1c1
Sequence:CCGGGCAATGATATTCTCCTGTATTCTCGAGAATACAGGAGAATATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152481.1-239s1c1
Sequence:CCGGGCCTCACCAATATTTCCAATACTCGAGTATTGGAAATATTGGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152481
FAM187B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 187, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000135496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152481.1-657s1c1
Sequence:CCGGGTGCACCAATAACACACAGTTCTCGAGAACTGTGTGTTATTGGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152481.1-349s1c1
Sequence:CCGGCAAGTGGTGCAGTATGAAATTCTCGAGAATTTCATACTGCACCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152481.1-355s1c1
Sequence:CCGGGTGCAGTATGAAATTGACTTTCTCGAGAAAGTCAATTTCATACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152481.1-155s1c1
Sequence:CCGGGCAATGATATTCTCCTGTATTCTCGAGAATACAGGAGAATATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152481.1-239s1c1
Sequence:CCGGGCCTCACCAATATTTCCAATACTCGAGTATTGGAAATATTGGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152481
FAM187B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 187, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000135496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152481.1-657s1c1
Sequence:CCGGGTGCACCAATAACACACAGTTCTCGAGAACTGTGTGTTATTGGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152481.1-349s1c1
Sequence:CCGGCAAGTGGTGCAGTATGAAATTCTCGAGAATTTCATACTGCACCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152481.1-355s1c1
Sequence:CCGGGTGCAGTATGAAATTGACTTTCTCGAGAAAGTCAATTTCATACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152481.1-155s1c1
Sequence:CCGGGCAATGATATTCTCCTGTATTCTCGAGAATACAGGAGAATATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152481.1-239s1c1
Sequence:CCGGGCCTCACCAATATTTCCAATACTCGAGTATTGGAAATATTGGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175240
FAM187B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 187, member B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175240.2-659s1c1
Sequence:CCGGGTACTTTGTCTTTGACACATACTCGAGTATGTGTCAAAGACAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175240.2-457s1c1
Sequence:CCGGCTTGGCAAGATTGTAACCGTTCTCGAGAACGGTTACAATCTTGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175240.2-462s1c1
Sequence:CCGGCAAGATTGTAACCGTTGCCAACTCGAGTTGGCAACGGTTACAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175240.2-344s1c1
Sequence:CCGGCTTTCAGAACATAGCTCTGTTCTCGAGAACAGAGCTATGTTCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175240.4-499s21c1
Sequence:CCGGACGTCTAGGCTACTGCTATGTCTCGAGACATAGCAGTAGCCTAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175240.4-126s21c1
Sequence:CCGGTCTCAGGCAGTGACGTGATACCTCGAGGTATCACGTCACTGCCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175240.4-1262s21c1
Sequence:CCGGTGCTCGGCTTACCTATTGATCCTCGAGGATCAATAGGTAAGCCGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175240.4-183s21c1
Sequence:CCGGCTTCATCTTTAGAGGACAAACCTCGAGGTTTGTCCTCTAAAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175240.4-964s21c1
Sequence:CCGGCAAGGCAGACTCCGTTCTTAGCTCGAGCTAAGAACGGAGTCTGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175240
FAM187B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 187, member B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175240.2-659s1c1
Sequence:CCGGGTACTTTGTCTTTGACACATACTCGAGTATGTGTCAAAGACAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175240.2-457s1c1
Sequence:CCGGCTTGGCAAGATTGTAACCGTTCTCGAGAACGGTTACAATCTTGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175240.2-462s1c1
Sequence:CCGGCAAGATTGTAACCGTTGCCAACTCGAGTTGGCAACGGTTACAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175240.2-344s1c1
Sequence:CCGGCTTTCAGAACATAGCTCTGTTCTCGAGAACAGAGCTATGTTCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175240.4-499s21c1
Sequence:CCGGACGTCTAGGCTACTGCTATGTCTCGAGACATAGCAGTAGCCTAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175240.4-126s21c1
Sequence:CCGGTCTCAGGCAGTGACGTGATACCTCGAGGTATCACGTCACTGCCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175240.4-1262s21c1
Sequence:CCGGTGCTCGGCTTACCTATTGATCCTCGAGGATCAATAGGTAAGCCGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175240.4-183s21c1
Sequence:CCGGCTTCATCTTTAGAGGACAAACCTCGAGGTTTGTCCTCTAAAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175240.4-964s21c1
Sequence:CCGGCAAGGCAGACTCCGTTCTTAGCTCGAGCTAAGAACGGAGTCTGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175240
FAM187B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 187, member B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175240.2-659s1c1
Sequence:CCGGGTACTTTGTCTTTGACACATACTCGAGTATGTGTCAAAGACAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175240.2-457s1c1
Sequence:CCGGCTTGGCAAGATTGTAACCGTTCTCGAGAACGGTTACAATCTTGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175240.2-462s1c1
Sequence:CCGGCAAGATTGTAACCGTTGCCAACTCGAGTTGGCAACGGTTACAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175240.2-344s1c1
Sequence:CCGGCTTTCAGAACATAGCTCTGTTCTCGAGAACAGAGCTATGTTCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175240.4-499s21c1
Sequence:CCGGACGTCTAGGCTACTGCTATGTCTCGAGACATAGCAGTAGCCTAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175240.4-126s21c1
Sequence:CCGGTCTCAGGCAGTGACGTGATACCTCGAGGTATCACGTCACTGCCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175240.4-1262s21c1
Sequence:CCGGTGCTCGGCTTACCTATTGATCCTCGAGGATCAATAGGTAAGCCGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175240.4-183s21c1
Sequence:CCGGCTTCATCTTTAGAGGACAAACCTCGAGGTTTGTCCTCTAAAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175240.4-964s21c1
Sequence:CCGGCAAGGCAGACTCCGTTCTTAGCTCGAGCTAAGAACGGAGTCTGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks