EMAIL THIS PAGE TO A FRIEND

FAM188A

family with sequence similarity 188, member A

90 Gene Product Result for
Synonyms: C10orf97 CARP DERP5 MST126 RP11-394I23.1 my042
Gene ID:
Human(80013) Summary: C10ORF97 is a member of the caspase-associated recruitment domain (CARD) family of proteins that play a role in apoptosis (Liu et al., 2002 [PubMed 12054670]
Mouse(66960) family with sequence similarity 188, member A
Rat(291320) family with sequence similarity 188, member A
Zebrafish(777708) family with sequence similarity 188, member A
chicken(420526) family with sequence similarity 188, member A
domestic cat(101090526) family with sequence similarity 188, member A
cow(538509) family with sequence similarity 188, member A
dog(487118) family with sequence similarity 188, member A
sheep(101109726) family with sequence similarity 188, member A
domestic guinea pig(100721663) family with sequence similarity 188, member A
naked mole-rat(101723301) family with sequence similarity 188, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024948 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024185 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024185 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024185 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024948 Rosetta Predictions human pricing
NM_001106122 Rosetta Predictions rat pricing
NM_024185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110290 predicted 1528
2 SASI_Hs01_00110291 predicted 838
3 SASI_Hs01_00110292 predicted 1641
4 SASI_Hs01_00110293 predicted 1294
5 SASI_Hs01_00110294 predicted 788
6 SASI_Hs01_00110295 predicted 1458
7 SASI_Hs01_00110296 predicted 477
8 SASI_Hs01_00110297 predicted 778
9 SASI_Hs01_00110298 predicted 1487
10 SASI_Hs01_00110299 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215838 predicted 951
2 SASI_Rn02_00215839 predicted 1509
3 SASI_Rn02_00215840 predicted 445
4 SASI_Rn02_00215841 predicted 746
5 SASI_Rn02_00215842 predicted 1608
6 SASI_Rn02_00215843 predicted 741
7 SASI_Rn02_00215844 predicted 973
8 SASI_Rn02_00215845 predicted 1584
9 SASI_Rn02_00215846 predicted 1454
10 SASI_Rn02_00215847 predicted 1156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033307 predicted 1155
2 SASI_Mm01_00033308 predicted 912
3 SASI_Mm01_00033309 predicted 1537
4 SASI_Mm01_00033310 predicted 1364
5 SASI_Mm01_00033311 predicted 1214
6 SASI_Mm01_00033313 predicted 763
7 SASI_Mm01_00033314 predicted 763
8 SASI_Mm01_00033315 predicted 1474
9 SASI_Mm01_00033316 predicted 960
10 SASI_Mm02_00327508 predicted 588
11 SASI_Mm01_00033312 predicted 1124
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024948
VALIDATED
FAM188A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 188, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024948.2-1945s21c1
Sequence:CCGGTGAATGATTCCGGCTTGTAATCTCGAGATTACAAGCCGGAATCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024948.2-692s21c1
Sequence:CCGGGTTCAGAAGTTTACCAGAATTCTCGAGAATTCTGGTAAACTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024948.2-568s21c1
Sequence:CCGGCTGAGGAAACTGCTAGTATTTCTCGAGAAATACTAGCAGTTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024948.2-840s21c1
Sequence:CCGGCCCTTGATAGATCCTGTATATCTCGAGATATACAGGATCTATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024948.1-840s1c1
Sequence:CCGGCCCTTGATAGATCCTGTATATCTCGAGATATACAGGATCTATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024948.1-1098s1c1
Sequence:CCGGGCCAAGGATATGGCTTTAGTTCTCGAGAACTAAAGCCATATCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024948.1-692s1c1
Sequence:CCGGGTTCAGAAGTTTACCAGAATTCTCGAGAATTCTGGTAAACTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024948.1-1376s1c1
Sequence:CCGGCAATGGATTGAAGCAGTCAAACTCGAGTTTGACTGCTTCAATCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024948.1-568s1c1
Sequence:CCGGCTGAGGAAACTGCTAGTATTTCTCGAGAAATACTAGCAGTTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024948
VALIDATED
FAM188A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 188, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024948.2-1945s21c1
Sequence:CCGGTGAATGATTCCGGCTTGTAATCTCGAGATTACAAGCCGGAATCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024948.2-692s21c1
Sequence:CCGGGTTCAGAAGTTTACCAGAATTCTCGAGAATTCTGGTAAACTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024948.2-568s21c1
Sequence:CCGGCTGAGGAAACTGCTAGTATTTCTCGAGAAATACTAGCAGTTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024948.2-840s21c1
Sequence:CCGGCCCTTGATAGATCCTGTATATCTCGAGATATACAGGATCTATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024948.1-840s1c1
Sequence:CCGGCCCTTGATAGATCCTGTATATCTCGAGATATACAGGATCTATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024948.1-1098s1c1
Sequence:CCGGGCCAAGGATATGGCTTTAGTTCTCGAGAACTAAAGCCATATCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024948.1-692s1c1
Sequence:CCGGGTTCAGAAGTTTACCAGAATTCTCGAGAATTCTGGTAAACTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024948.1-1376s1c1
Sequence:CCGGCAATGGATTGAAGCAGTCAAACTCGAGTTTGACTGCTTCAATCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024948.1-568s1c1
Sequence:CCGGCTGAGGAAACTGCTAGTATTTCTCGAGAAATACTAGCAGTTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024948
VALIDATED
FAM188A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 188, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024948.2-1945s21c1
Sequence:CCGGTGAATGATTCCGGCTTGTAATCTCGAGATTACAAGCCGGAATCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024948.2-692s21c1
Sequence:CCGGGTTCAGAAGTTTACCAGAATTCTCGAGAATTCTGGTAAACTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024948.2-568s21c1
Sequence:CCGGCTGAGGAAACTGCTAGTATTTCTCGAGAAATACTAGCAGTTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024948.2-840s21c1
Sequence:CCGGCCCTTGATAGATCCTGTATATCTCGAGATATACAGGATCTATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024948.1-840s1c1
Sequence:CCGGCCCTTGATAGATCCTGTATATCTCGAGATATACAGGATCTATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024948.1-1098s1c1
Sequence:CCGGGCCAAGGATATGGCTTTAGTTCTCGAGAACTAAAGCCATATCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024948.1-692s1c1
Sequence:CCGGGTTCAGAAGTTTACCAGAATTCTCGAGAATTCTGGTAAACTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024948.1-1376s1c1
Sequence:CCGGCAATGGATTGAAGCAGTCAAACTCGAGTTTGACTGCTTCAATCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024948.1-568s1c1
Sequence:CCGGCTGAGGAAACTGCTAGTATTTCTCGAGAAATACTAGCAGTTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024185
VALIDATED
FAM188A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 188, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024185.4-1058s21c1
Sequence:CCGGGAAACTCACCTCACCGTATTTCTCGAGAAATACGGTGAGGTGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024185.4-1991s21c1
Sequence:CCGGATTATAGACCCTGGCTATTTGCTCGAGCAAATAGCCAGGGTCTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024185.4-981s21c1
Sequence:CCGGTAATGGAAGCTTTACGATATTCTCGAGAATATCGTAAAGCTTCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024185.4-1450s21c1
Sequence:CCGGGACAGACGACACTCCTATTAACTCGAGTTAATAGGAGTGTCGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024185.4-644s21c1
Sequence:CCGGGAGCGATTTCATGCATTAATTCTCGAGAATTAATGCATGAAATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024185
VALIDATED
FAM188A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 188, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024185.4-1058s21c1
Sequence:CCGGGAAACTCACCTCACCGTATTTCTCGAGAAATACGGTGAGGTGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024185.4-1991s21c1
Sequence:CCGGATTATAGACCCTGGCTATTTGCTCGAGCAAATAGCCAGGGTCTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024185.4-981s21c1
Sequence:CCGGTAATGGAAGCTTTACGATATTCTCGAGAATATCGTAAAGCTTCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024185.4-1450s21c1
Sequence:CCGGGACAGACGACACTCCTATTAACTCGAGTTAATAGGAGTGTCGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024185.4-644s21c1
Sequence:CCGGGAGCGATTTCATGCATTAATTCTCGAGAATTAATGCATGAAATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024185
VALIDATED
FAM188A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 188, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024185.4-1058s21c1
Sequence:CCGGGAAACTCACCTCACCGTATTTCTCGAGAAATACGGTGAGGTGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024185.4-1991s21c1
Sequence:CCGGATTATAGACCCTGGCTATTTGCTCGAGCAAATAGCCAGGGTCTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024185.4-981s21c1
Sequence:CCGGTAATGGAAGCTTTACGATATTCTCGAGAATATCGTAAAGCTTCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024185.4-1450s21c1
Sequence:CCGGGACAGACGACACTCCTATTAACTCGAGTTAATAGGAGTGTCGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024185.4-644s21c1
Sequence:CCGGGAGCGATTTCATGCATTAATTCTCGAGAATTAATGCATGAAATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks