EMAIL THIS PAGE TO A FRIEND

FAM188B

family with sequence similarity 188, member B

60 Gene Product Result for
Synonyms: C7orf67
UniProtKB ID: Q4G0A6, Q71AZ7, Q9H6D2
Gene ID:
Mouse(330323) family with sequence similarity 188, member B
Rat(312365) family with sequence similarity 188, member B
naked mole-rat(101711715) family with sequence similarity 188, member B
domestic guinea pig(100715588) family with sequence similarity 188, member B
sheep(101123030) family with sequence similarity 188, member B
chicken(420383) family with sequence similarity 188, member B
cow(615509) family with sequence similarity 188, member B
domestic cat(101087466) family with sequence similarity 188, member B
dog(475269) family with sequence similarity 188, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032222 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032222 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032222 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032222 Rosetta Predictions human pricing
XM_001058587 Rosetta Predictions rat pricing
XM_231787 Rosetta Predictions rat pricing
NM_177883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139144 predicted 2384
2 SASI_Hs01_00139145 predicted 1059
3 SASI_Hs01_00139146 predicted 277
4 SASI_Hs01_00139147 predicted 1164
5 SASI_Hs01_00139148 predicted 317
6 SASI_Hs01_00139149 predicted 299
7 SASI_Hs01_00139150 predicted 2101
8 SASI_Hs01_00139151 predicted 505
9 SASI_Hs01_00139152 predicted 316
10 SASI_Hs01_00139153 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290234 predicted 344
2 SASI_Rn02_00290235 predicted 245
3 SASI_Rn02_00290236 predicted 1645
4 SASI_Rn02_00290237 predicted 1495
5 SASI_Rn02_00290238 predicted 1284
6 SASI_Rn02_00290239 predicted 1680
7 SASI_Rn02_00290240 predicted 1497
8 SASI_Rn02_00290241 predicted 1394
9 SASI_Rn02_00290242 predicted 1362
10 SASI_Rn02_00290243 predicted 1510
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386951 predicted 341
2 SASI_Rn02_00386952 predicted 254
3 SASI_Rn02_00386953 predicted 1490
4 SASI_Rn02_00386954 predicted 1278
5 SASI_Rn02_00386955 predicted 341
6 SASI_Rn02_00386956 predicted 1506
7 SASI_Rn02_00386957 predicted 1396
8 SASI_Rn02_00386958 predicted 1363
9 SASI_Rn02_00386959 predicted 1513
10 SASI_Rn02_00386960 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348368 predicted 1251
2 SASI_Mm01_00090660 predicted 402
3 SASI_Mm01_00090661 predicted 783
4 SASI_Mm01_00090663 predicted 562
5 SASI_Mm01_00090664 predicted 352
6 SASI_Mm02_00348369 predicted 569
7 SASI_Mm01_00090665 predicted 1507
8 SASI_Mm01_00090666 predicted 345
9 SASI_Mm01_00090667 predicted 1213
10 SASI_Mm01_00090668 predicted 1318
11 SASI_Mm01_00090659 predicted 468
12 SASI_Mm01_00090662 predicted 1496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032222
FAM188B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 188, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032222.1-1321s1c1
Sequence:CCGGCCTTCTGTTTGGTTCCAGCTTCTCGAGAAGCTGGAACCAAACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032222.1-295s1c1
Sequence:CCGGCAGATACTTTCTGGATCACTTCTCGAGAAGTGATCCAGAAAGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032222.1-313s1c1
Sequence:CCGGCTTTGGAAATACGGCTAACAACTCGAGTTGTTAGCCGTATTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032222.1-890s1c1
Sequence:CCGGCAGCTTAGTGAACTGACCGTACTCGAGTACGGTCAGTTCACTAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032222.1-280s1c1
Sequence:CCGGCCTTGAACTCATCACCAGATACTCGAGTATCTGGTGATGAGTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136406    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032222.1-2025s1c1
Sequence:CCGGCATTACAACATGTGCCAGGTTCTCGAGAACCTGGCACATGTTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032222.2-2350s21c1
Sequence:CCGGGACCGTTGGATGTGGGTAAACCTCGAGGTTTACCCACATCCAACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032222.2-512s21c1
Sequence:CCGGTGGAGATGTACTTGGTAATTTCTCGAGAAATTACCAAGTACATCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032222.2-1988s21c1
Sequence:CCGGCATTGCTGCACGCAGTGATATCTCGAGATATCACTGCGTGCAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032222
FAM188B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 188, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032222.1-1321s1c1
Sequence:CCGGCCTTCTGTTTGGTTCCAGCTTCTCGAGAAGCTGGAACCAAACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032222.1-295s1c1
Sequence:CCGGCAGATACTTTCTGGATCACTTCTCGAGAAGTGATCCAGAAAGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032222.1-313s1c1
Sequence:CCGGCTTTGGAAATACGGCTAACAACTCGAGTTGTTAGCCGTATTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032222.1-890s1c1
Sequence:CCGGCAGCTTAGTGAACTGACCGTACTCGAGTACGGTCAGTTCACTAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032222.1-280s1c1
Sequence:CCGGCCTTGAACTCATCACCAGATACTCGAGTATCTGGTGATGAGTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136406    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032222.1-2025s1c1
Sequence:CCGGCATTACAACATGTGCCAGGTTCTCGAGAACCTGGCACATGTTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032222.2-2350s21c1
Sequence:CCGGGACCGTTGGATGTGGGTAAACCTCGAGGTTTACCCACATCCAACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032222.2-512s21c1
Sequence:CCGGTGGAGATGTACTTGGTAATTTCTCGAGAAATTACCAAGTACATCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032222.2-1988s21c1
Sequence:CCGGCATTGCTGCACGCAGTGATATCTCGAGATATCACTGCGTGCAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032222
FAM188B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 188, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032222.1-1321s1c1
Sequence:CCGGCCTTCTGTTTGGTTCCAGCTTCTCGAGAAGCTGGAACCAAACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032222.1-295s1c1
Sequence:CCGGCAGATACTTTCTGGATCACTTCTCGAGAAGTGATCCAGAAAGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032222.1-313s1c1
Sequence:CCGGCTTTGGAAATACGGCTAACAACTCGAGTTGTTAGCCGTATTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032222.1-890s1c1
Sequence:CCGGCAGCTTAGTGAACTGACCGTACTCGAGTACGGTCAGTTCACTAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032222.1-280s1c1
Sequence:CCGGCCTTGAACTCATCACCAGATACTCGAGTATCTGGTGATGAGTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136406    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032222.1-2025s1c1
Sequence:CCGGCATTACAACATGTGCCAGGTTCTCGAGAACCTGGCACATGTTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032222.2-2350s21c1
Sequence:CCGGGACCGTTGGATGTGGGTAAACCTCGAGGTTTACCCACATCCAACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032222.2-512s21c1
Sequence:CCGGTGGAGATGTACTTGGTAATTTCTCGAGAAATTACCAAGTACATCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032222.2-1988s21c1
Sequence:CCGGCATTGCTGCACGCAGTGATATCTCGAGATATCACTGCGTGCAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177883
FAM188B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 188, member B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177883.2-1400s1c1
Sequence:CCGGCAATGACATTGCCTCGTTAAACTCGAGTTTAACGAGGCAATGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177883.2-1953s1c1
Sequence:CCGGCCCTCCATATGCATTGGTATACTCGAGTATACCAATGCATATGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177883.2-1233s1c1
Sequence:CCGGGAGTTGATAAAGGAAGACATTCTCGAGAATGTCTTCCTTTATCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177883.4-339s21c1
Sequence:CCGGAGCTCATTACCAGGTACTTTCCTCGAGGAAAGTACCTGGTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177883.4-1177s21c1
Sequence:CCGGGTCTGACAGGACGGATGATAACTCGAGTTATCATCCGTCCTGTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177883.4-2023s21c1
Sequence:CCGGTGCCCTTCCCAAATCTTTATTCTCGAGAATAAAGATTTGGGAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177883.4-681s21c1
Sequence:CCGGACTCATCAGAGCCCGGTATAGCTCGAGCTATACCGGGCTCTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177883.4-1398s21c1
Sequence:CCGGTCAATGACATTGCCTCGTTAACTCGAGTTAACGAGGCAATGTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177883
FAM188B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 188, member B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177883.2-1400s1c1
Sequence:CCGGCAATGACATTGCCTCGTTAAACTCGAGTTTAACGAGGCAATGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177883.2-1953s1c1
Sequence:CCGGCCCTCCATATGCATTGGTATACTCGAGTATACCAATGCATATGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177883.2-1233s1c1
Sequence:CCGGGAGTTGATAAAGGAAGACATTCTCGAGAATGTCTTCCTTTATCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177883.4-339s21c1
Sequence:CCGGAGCTCATTACCAGGTACTTTCCTCGAGGAAAGTACCTGGTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177883.4-1177s21c1
Sequence:CCGGGTCTGACAGGACGGATGATAACTCGAGTTATCATCCGTCCTGTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177883.4-2023s21c1
Sequence:CCGGTGCCCTTCCCAAATCTTTATTCTCGAGAATAAAGATTTGGGAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177883.4-681s21c1
Sequence:CCGGACTCATCAGAGCCCGGTATAGCTCGAGCTATACCGGGCTCTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177883.4-1398s21c1
Sequence:CCGGTCAATGACATTGCCTCGTTAACTCGAGTTAACGAGGCAATGTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177883
FAM188B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 188, member B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177883.2-1400s1c1
Sequence:CCGGCAATGACATTGCCTCGTTAAACTCGAGTTTAACGAGGCAATGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177883.2-1953s1c1
Sequence:CCGGCCCTCCATATGCATTGGTATACTCGAGTATACCAATGCATATGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177883.2-1233s1c1
Sequence:CCGGGAGTTGATAAAGGAAGACATTCTCGAGAATGTCTTCCTTTATCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177883.4-339s21c1
Sequence:CCGGAGCTCATTACCAGGTACTTTCCTCGAGGAAAGTACCTGGTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177883.4-1177s21c1
Sequence:CCGGGTCTGACAGGACGGATGATAACTCGAGTTATCATCCGTCCTGTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177883.4-2023s21c1
Sequence:CCGGTGCCCTTCCCAAATCTTTATTCTCGAGAATAAAGATTTGGGAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177883.4-681s21c1
Sequence:CCGGACTCATCAGAGCCCGGTATAGCTCGAGCTATACCGGGCTCTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177883.4-1398s21c1
Sequence:CCGGTCAATGACATTGCCTCGTTAACTCGAGTTAACGAGGCAATGTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks