EMAIL THIS PAGE TO A FRIEND

FAM189A2

family with sequence similarity 189, member A2

77 Gene Product Result for
Synonyms: C9orf61 RP11-548B3.1 X123
UniProtKB ID: Q15884, Q14CN5, Q5T6C8, Q5T6C9, Q6ZTX4, Q96N10
Gene ID:
Mouse(381217) family with sequence similarity 189, member A2
Rat(309415) family with sequence similarity 189, member A2
Zebrafish(503960) family with sequence similarity 189, member A2
cow(509420) family with sequence similarity 189, member A2
domestic cat(101082348) family with sequence similarity 189, member A2
dog(609015) family with sequence similarity 189, member A2
chicken(427245) family with sequence similarity 189, member A2
naked mole-rat(101716196) family with sequence similarity 189, member A2
domestic guinea pig(100730093) family with sequence similarity 189, member A2
sheep(101116128) family with sequence similarity 189, member A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004816 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004816 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004816 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001114174 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001114174 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001114174 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082631 MISSION® esiRNA esiRNA human C9orf61 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127608 Rosetta Predictions human pricing
NM_004816 Rosetta Predictions human pricing
XM_001078764 Rosetta Predictions rat pricing
XM_219909 Rosetta Predictions rat pricing
NM_001114174 Rosetta Predictions mouse pricing
XM_355152 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329854 predicted 296
2 SASI_Hs02_00329855 predicted 1754
3 SASI_Hs02_00329856 predicted 319
4 SASI_Hs02_00329857 predicted 1151
5 SASI_Hs02_00329858 predicted 644
6 SASI_Hs02_00329859 predicted 1873
7 SASI_Hs02_00329860 predicted 1827
8 SASI_Hs02_00329861 predicted 623
9 SASI_Hs02_00329862 predicted 1886
10 SASI_Hs02_00329863 predicted 1856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059336 predicted 613
2 SASI_Hs02_00338366 predicted 2073
3 SASI_Hs01_00059337 predicted 639
4 SASI_Hs01_00059338 predicted 1475
5 SASI_Hs01_00059339 predicted 952
6 SASI_Hs02_00338367 predicted 2193
7 SASI_Hs02_00338368 predicted 2138
8 SASI_Hs01_00059344 predicted 941
9 SASI_Hs02_00338369 predicted 2197
10 SASI_Hs02_00338370 predicted 2174
11 SASI_Hs01_00059340 predicted 471
12 SASI_Hs01_00059341 predicted 652
13 SASI_Hs01_00059342 predicted 456
14 SASI_Hs01_00059343 predicted 577
15 SASI_Hs01_00059345 predicted 1310
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078764 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361913 predicted 275
2 SASI_Rn02_00361914 predicted 259
3 SASI_Rn02_00361915 predicted 985
4 SASI_Rn02_00361916 predicted 1068
5 SASI_Rn02_00361917 predicted 523
6 SASI_Rn02_00361918 predicted 1131
7 SASI_Rn02_00361919 predicted 1055
8 SASI_Rn02_00361920 predicted 1471
9 SASI_Rn02_00361921 predicted 236
10 SASI_Rn02_00361922 predicted 911
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378855 predicted 279
2 SASI_Rn02_00378856 predicted 260
3 SASI_Rn02_00378857 predicted 980
4 SASI_Rn02_00378858 predicted 1060
5 SASI_Rn02_00378859 predicted 520
6 SASI_Rn02_00378860 predicted 1133
7 SASI_Rn02_00378861 predicted 1052
8 SASI_Rn02_00378862 predicted 1471
9 SASI_Rn02_00378863 predicted 228
10 SASI_Rn02_00378864 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308470 predicted 1573
2 SASI_Mm02_00308471 predicted 953
3 SASI_Mm02_00308472 predicted 708
4 SASI_Mm02_00308473 predicted 1262
5 SASI_Mm02_00308474 predicted 1568
6 SASI_Mm02_00308475 predicted 545
7 SASI_Mm02_00308476 predicted 1194
8 SASI_Mm02_00308477 predicted 1501
9 SASI_Mm02_00308478 predicted 1256
10 SASI_Mm02_00308479 predicted 1591
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273587 predicted 1698
2 SASI_Mm01_00273588 predicted 1088
3 SASI_Mm01_00273589 predicted 842
4 SASI_Mm01_00273590 predicted 1394
5 SASI_Mm01_00273591 predicted 1691
6 SASI_Mm01_00273592 predicted 1321
7 SASI_Mm01_00273593 predicted 1622
8 SASI_Mm01_00273594 predicted 1776
9 SASI_Mm01_00273595 predicted 1383
10 SASI_Mm01_00273596 predicted 1719
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004816
VALIDATED
FAM189A2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 189, member A2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004816.3-619s21c1
Sequence:CCGGGCCTTGAAACTCTTTCCGGTTCTCGAGAACCGGAAAGAGTTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004816.3-739s21c1
Sequence:CCGGCTCCGCTACCTCCAGATATTCCTCGAGGAATATCTGGAGGTAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004816.3-2191s21c1
Sequence:CCGGCTCTGCGATTTGGCAGGAAATCTCGAGATTTCCTGCCAAATCGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004816.3-768s21c1
Sequence:CCGGGAGATCCTGCATCGATGAATCCTCGAGGATTCATCGATGCAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004816.3-1383s21c1
Sequence:CCGGACCGCGGTCTTTGATAGATTACTCGAGTAATCTATCAAAGACCGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004816.2-976s1c1
Sequence:CCGGGAAGTGTTCTGTCCTCTGGATCTCGAGATCCAGAGGACAGAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004816.2-468s1c1
Sequence:CCGGCCTCTTAAATCTAGCTGGATTCTCGAGAATCCAGCTAGATTTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004816.2-2192s1c1
Sequence:CCGGCTCTGCGATTTGGCAGGAAATCTCGAGATTTCCTGCCAAATCGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004816.2-958s1c1
Sequence:CCGGGCTCGAATCAAAGGTGTGGAACTCGAGTTCCACACCTTTGATTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004816.2-619s1c1
Sequence:CCGGGCCTTGAAACTCTTTCCGGTTCTCGAGAACCGGAAAGAGTTTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004816.2-1512s1c1
Sequence:CCGGGAAATCTGATGAGGAGCACATCTCGAGATGTGCTCCTCATCAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004816.2-1135s1c1
Sequence:CCGGCCTAACATACCTGCCGAAGAACTCGAGTTCTTCGGCAGGTATGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129172    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004816.2-2263s1c1
Sequence:CCGGCCCTCAAATCACACTCTCTTTCTCGAGAAAGAGAGTGTGATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004816
VALIDATED
FAM189A2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 189, member A2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004816.3-619s21c1
Sequence:CCGGGCCTTGAAACTCTTTCCGGTTCTCGAGAACCGGAAAGAGTTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004816.3-739s21c1
Sequence:CCGGCTCCGCTACCTCCAGATATTCCTCGAGGAATATCTGGAGGTAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004816.3-2191s21c1
Sequence:CCGGCTCTGCGATTTGGCAGGAAATCTCGAGATTTCCTGCCAAATCGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004816.3-768s21c1
Sequence:CCGGGAGATCCTGCATCGATGAATCCTCGAGGATTCATCGATGCAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004816.3-1383s21c1
Sequence:CCGGACCGCGGTCTTTGATAGATTACTCGAGTAATCTATCAAAGACCGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004816.2-976s1c1
Sequence:CCGGGAAGTGTTCTGTCCTCTGGATCTCGAGATCCAGAGGACAGAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004816.2-468s1c1
Sequence:CCGGCCTCTTAAATCTAGCTGGATTCTCGAGAATCCAGCTAGATTTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004816.2-2192s1c1
Sequence:CCGGCTCTGCGATTTGGCAGGAAATCTCGAGATTTCCTGCCAAATCGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004816.2-958s1c1
Sequence:CCGGGCTCGAATCAAAGGTGTGGAACTCGAGTTCCACACCTTTGATTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004816.2-619s1c1
Sequence:CCGGGCCTTGAAACTCTTTCCGGTTCTCGAGAACCGGAAAGAGTTTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004816.2-1512s1c1
Sequence:CCGGGAAATCTGATGAGGAGCACATCTCGAGATGTGCTCCTCATCAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004816.2-1135s1c1
Sequence:CCGGCCTAACATACCTGCCGAAGAACTCGAGTTCTTCGGCAGGTATGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129172    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004816.2-2263s1c1
Sequence:CCGGCCCTCAAATCACACTCTCTTTCTCGAGAAAGAGAGTGTGATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004816
VALIDATED
FAM189A2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 189, member A2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004816.3-619s21c1
Sequence:CCGGGCCTTGAAACTCTTTCCGGTTCTCGAGAACCGGAAAGAGTTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004816.3-739s21c1
Sequence:CCGGCTCCGCTACCTCCAGATATTCCTCGAGGAATATCTGGAGGTAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004816.3-2191s21c1
Sequence:CCGGCTCTGCGATTTGGCAGGAAATCTCGAGATTTCCTGCCAAATCGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004816.3-768s21c1
Sequence:CCGGGAGATCCTGCATCGATGAATCCTCGAGGATTCATCGATGCAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004816.3-1383s21c1
Sequence:CCGGACCGCGGTCTTTGATAGATTACTCGAGTAATCTATCAAAGACCGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004816.2-976s1c1
Sequence:CCGGGAAGTGTTCTGTCCTCTGGATCTCGAGATCCAGAGGACAGAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004816.2-468s1c1
Sequence:CCGGCCTCTTAAATCTAGCTGGATTCTCGAGAATCCAGCTAGATTTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004816.2-2192s1c1
Sequence:CCGGCTCTGCGATTTGGCAGGAAATCTCGAGATTTCCTGCCAAATCGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004816.2-958s1c1
Sequence:CCGGGCTCGAATCAAAGGTGTGGAACTCGAGTTCCACACCTTTGATTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004816.2-619s1c1
Sequence:CCGGGCCTTGAAACTCTTTCCGGTTCTCGAGAACCGGAAAGAGTTTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004816.2-1512s1c1
Sequence:CCGGGAAATCTGATGAGGAGCACATCTCGAGATGTGCTCCTCATCAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004816.2-1135s1c1
Sequence:CCGGCCTAACATACCTGCCGAAGAACTCGAGTTCTTCGGCAGGTATGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129172    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004816.2-2263s1c1
Sequence:CCGGCCCTCAAATCACACTCTCTTTCTCGAGAAAGAGAGTGTGATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001114174
FAM189A2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 189, member A2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114174.1-2307s21c1
Sequence:CCGGGCAGGAGACATGATGGTTAACCTCGAGGTTAACCATCATGTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114174.1-837s21c1
Sequence:CCGGTGCGCTACCTCCAGATCTTTGCTCGAGCAAAGATCTGGAGGTAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114174.1-1194s21c1
Sequence:CCGGAGCCAGTTTGCACGCAGATAACTCGAGTTATCTGCGTGCAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114174.1-1257s21c1
Sequence:CCGGCATCTGGATCAACTCCTATTCCTCGAGGAATAGGAGTTGATCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114174.1-1579s21c1
Sequence:CCGGTGAACTTGTAGAGAACATAAACTCGAGTTTATGTTCTCTACAAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001114174
FAM189A2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 189, member A2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114174.1-2307s21c1
Sequence:CCGGGCAGGAGACATGATGGTTAACCTCGAGGTTAACCATCATGTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114174.1-837s21c1
Sequence:CCGGTGCGCTACCTCCAGATCTTTGCTCGAGCAAAGATCTGGAGGTAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114174.1-1194s21c1
Sequence:CCGGAGCCAGTTTGCACGCAGATAACTCGAGTTATCTGCGTGCAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114174.1-1257s21c1
Sequence:CCGGCATCTGGATCAACTCCTATTCCTCGAGGAATAGGAGTTGATCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114174.1-1579s21c1
Sequence:CCGGTGAACTTGTAGAGAACATAAACTCGAGTTTATGTTCTCTACAAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001114174
FAM189A2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 189, member A2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114174.1-2307s21c1
Sequence:CCGGGCAGGAGACATGATGGTTAACCTCGAGGTTAACCATCATGTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114174.1-837s21c1
Sequence:CCGGTGCGCTACCTCCAGATCTTTGCTCGAGCAAAGATCTGGAGGTAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114174.1-1194s21c1
Sequence:CCGGAGCCAGTTTGCACGCAGATAACTCGAGTTATCTGCGTGCAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114174.1-1257s21c1
Sequence:CCGGCATCTGGATCAACTCCTATTCCTCGAGGAATAGGAGTTGATCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114174.1-1579s21c1
Sequence:CCGGTGAACTTGTAGAGAACATAAACTCGAGTTTATGTTCTCTACAAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks