EMAIL THIS PAGE TO A FRIEND

FAM189B

family with sequence similarity 189, member B

129 Gene Product Result for
Synonyms: C1orf2 COTE1
UniProtKB ID: P81408, B1AVS5, Q8IXL3, Q9BR66
Gene ID:
Human(10712) Summary: This gene is located near the gene for the lysosomal enzyme glucosylceramidase; a deficiency in this enzyme is associated with Gaucher disease. The encoded protein has been identified as a potential binding partner of a WW domain-containing protein which is involved in apoptosis and tumor suppression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Mouse(68521) family with sequence similarity 189, member B
Rat(310640) family with sequence similarity 189, member B
sheep(101117807) family with sequence similarity 189, member B
domestic guinea pig(100715723) family with sequence similarity 189, member B
naked mole-rat(101702079) family with sequence similarity 189, member B
dog(490428) family with sequence similarity 189, member B
cow(100300734) family with sequence similarity 189, member B
domestic cat(101088978) family with sequence similarity 189, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198264 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001014995 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001014995 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001014995 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU167301 MISSION® esiRNA esiRNA targeting mouse Fam189b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006589 Rosetta Predictions human pricing
NM_198264 Rosetta Predictions human pricing
NM_001107690 Rosetta Predictions rat pricing
NM_001014995 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341894 predicted 2110
2 SASI_Hs01_00124308 predicted 1391
3 SASI_Hs01_00124309 predicted 2598
4 SASI_Hs01_00124310 predicted 2414
5 SASI_Hs01_00124312 predicted 2366
6 SASI_Hs01_00124313 predicted 2497
7 SASI_Hs01_00124314 predicted 1515
8 SASI_Hs01_00124315 predicted 2087
9 SASI_Hs02_00341895 predicted 1520
10 SASI_Hs02_00341896 predicted 2496
11 SASI_Hs01_00124307 predicted 2120
12 SASI_Hs01_00124311 predicted 1409
13 SASI_Hs01_00124316 predicted 1630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371811 predicted 1821
2 SASI_Hs01_00225385 predicted 1104
3 SASI_Hs01_00225386 predicted 2309
4 SASI_Hs01_00225387 predicted 2121
5 SASI_Hs01_00225389 predicted 2079
6 SASI_Hs01_00225390 predicted 2205
7 SASI_Hs01_00225391 predicted 1235
8 SASI_Hs01_00225392 predicted 1798
9 SASI_Hs02_00371812 predicted 1228
10 SASI_Hs02_00371813 predicted 2205
11 SASI_Hs01_00225384 predicted 1833
12 SASI_Hs01_00225388 predicted 1115
13 SASI_Hs01_00225393 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231315 predicted 1277
2 SASI_Rn02_00231316 predicted 1265
3 SASI_Rn02_00231317 predicted 2115
4 SASI_Rn02_00231318 predicted 2481
5 SASI_Rn02_00231319 predicted 2517
6 SASI_Rn02_00231320 predicted 759
7 SASI_Rn02_00231321 predicted 909
8 SASI_Rn02_00231322 predicted 748
9 SASI_Rn02_00231323 predicted 863
10 SASI_Rn02_00231324 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014995 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196715 predicted 1047
2 SASI_Mm01_00196716 predicted 2003
3 SASI_Mm02_00287451 predicted 1034
4 SASI_Mm01_00196717 predicted 1298
5 SASI_Mm01_00196718 predicted 1281
6 SASI_Mm01_00196720 predicted 1038
7 SASI_Mm01_00196721 predicted 2498
8 SASI_Mm01_00196722 predicted 2125
9 SASI_Mm01_00196723 predicted 2510
10 SASI_Mm01_00196724 predicted 764
11 SASI_Mm01_00196719 predicted 1250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198264
FAM189B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 189, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198264.1-1105s1c1
Sequence:CCGGGCACAGAGCATCACGTACAATCTCGAGATTGTACGTGATGCTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198264.1-1113s1c1
Sequence:CCGGCATCACGTACAATGGCTCCATCTCGAGATGGAGCCATTGTACGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198264.1-1840s1c1
Sequence:CCGGGACCTTTATACCAAAGTGCTTCTCGAGAAGCACTTTGGTATAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198264.1-2663s1c1
Sequence:CCGGCCAGGTGTTTAAGTACAGGGTCTCGAGACCCTGTACTTAAACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198264.1-1105s21c1
Sequence:CCGGGCACAGAGCATCACGTACAATCTCGAGATTGTACGTGATGCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198264.1-1113s21c1
Sequence:CCGGCATCACGTACAATGGCTCCATCTCGAGATGGAGCCATTGTACGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198264.1-1840s21c1
Sequence:CCGGGACCTTTATACCAAAGTGCTTCTCGAGAAGCACTTTGGTATAAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198264.1-2663s21c1
Sequence:CCGGCCAGGTGTTTAAGTACAGGGTCTCGAGACCCTGTACTTAAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198264
FAM189B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 189, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198264.1-1105s1c1
Sequence:CCGGGCACAGAGCATCACGTACAATCTCGAGATTGTACGTGATGCTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198264.1-1113s1c1
Sequence:CCGGCATCACGTACAATGGCTCCATCTCGAGATGGAGCCATTGTACGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198264.1-1840s1c1
Sequence:CCGGGACCTTTATACCAAAGTGCTTCTCGAGAAGCACTTTGGTATAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198264.1-2663s1c1
Sequence:CCGGCCAGGTGTTTAAGTACAGGGTCTCGAGACCCTGTACTTAAACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198264.1-1105s21c1
Sequence:CCGGGCACAGAGCATCACGTACAATCTCGAGATTGTACGTGATGCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198264.1-1113s21c1
Sequence:CCGGCATCACGTACAATGGCTCCATCTCGAGATGGAGCCATTGTACGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198264.1-1840s21c1
Sequence:CCGGGACCTTTATACCAAAGTGCTTCTCGAGAAGCACTTTGGTATAAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198264.1-2663s21c1
Sequence:CCGGCCAGGTGTTTAAGTACAGGGTCTCGAGACCCTGTACTTAAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198264
FAM189B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 189, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198264.1-1105s1c1
Sequence:CCGGGCACAGAGCATCACGTACAATCTCGAGATTGTACGTGATGCTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198264.1-1113s1c1
Sequence:CCGGCATCACGTACAATGGCTCCATCTCGAGATGGAGCCATTGTACGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198264.1-1840s1c1
Sequence:CCGGGACCTTTATACCAAAGTGCTTCTCGAGAAGCACTTTGGTATAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198264.1-2663s1c1
Sequence:CCGGCCAGGTGTTTAAGTACAGGGTCTCGAGACCCTGTACTTAAACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198264.1-1105s21c1
Sequence:CCGGGCACAGAGCATCACGTACAATCTCGAGATTGTACGTGATGCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198264.1-1113s21c1
Sequence:CCGGCATCACGTACAATGGCTCCATCTCGAGATGGAGCCATTGTACGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198264.1-1840s21c1
Sequence:CCGGGACCTTTATACCAAAGTGCTTCTCGAGAAGCACTTTGGTATAAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198264.1-2663s21c1
Sequence:CCGGCCAGGTGTTTAAGTACAGGGTCTCGAGACCCTGTACTTAAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014995
FAM189B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 189, member B
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196131    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014995.1-2550s1c1
Sequence:CCGGGCCCATAAGCATTAGCTGGTTCTCGAGAACCAGCTAATGCTTATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014995.1-1887s1c1
Sequence:CCGGGCTTCAGTGATAGCTCAGGTTCTCGAGAACCTGAGCTATCACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014995.1-808s1c1
Sequence:CCGGGCTCTGTGTCATGCTTAGCATCTCGAGATGCTAAGCATGACACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014995.1-1286s1c1
Sequence:CCGGGATGCACAAAGCATCACGTATCTCGAGATACGTGATGCTTTGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014995.1-2849s1c1
Sequence:CCGGGTGTTTAAGAACACGGCGATTCTCGAGAATCGCCGTGTTCTTAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014995.1-1036s1c1
Sequence:CCGGCCTTACCATTTGTGCTGCAATCTCGAGATTGCAGCACAAATGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014995.1-2551s1c1
Sequence:CCGGCCCATAAGCATTAGCTGGTTACTCGAGTAACCAGCTAATGCTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014995.1-2012s21c1
Sequence:CCGGGCTGACTTCAGGGACCTTTATCTCGAGATAAAGGTCCCTGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014995.1-2310s21c1
Sequence:CCGGGAACTGGAGCCCATGGATATACTCGAGTATATCCATGGGCTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014995.1-1565s21c1
Sequence:CCGGTCTGTGCGCTCCGTCGATTATCTCGAGATAATCGACGGAGCGCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001014995.1-2813s21c1
Sequence:CCGGGATATTCCAGGGCACTGTATGCTCGAGCATACAGTGCCCTGGAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014995.1-627s21c1
Sequence:CCGGTCTTGGGCATCCTGGTGATAACTCGAGTTATCACCAGGATGCCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014995
FAM189B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 189, member B
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196131    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014995.1-2550s1c1
Sequence:CCGGGCCCATAAGCATTAGCTGGTTCTCGAGAACCAGCTAATGCTTATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014995.1-1887s1c1
Sequence:CCGGGCTTCAGTGATAGCTCAGGTTCTCGAGAACCTGAGCTATCACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014995.1-808s1c1
Sequence:CCGGGCTCTGTGTCATGCTTAGCATCTCGAGATGCTAAGCATGACACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014995.1-1286s1c1
Sequence:CCGGGATGCACAAAGCATCACGTATCTCGAGATACGTGATGCTTTGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014995.1-2849s1c1
Sequence:CCGGGTGTTTAAGAACACGGCGATTCTCGAGAATCGCCGTGTTCTTAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014995.1-1036s1c1
Sequence:CCGGCCTTACCATTTGTGCTGCAATCTCGAGATTGCAGCACAAATGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014995.1-2551s1c1
Sequence:CCGGCCCATAAGCATTAGCTGGTTACTCGAGTAACCAGCTAATGCTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014995.1-2012s21c1
Sequence:CCGGGCTGACTTCAGGGACCTTTATCTCGAGATAAAGGTCCCTGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014995.1-2310s21c1
Sequence:CCGGGAACTGGAGCCCATGGATATACTCGAGTATATCCATGGGCTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014995.1-1565s21c1
Sequence:CCGGTCTGTGCGCTCCGTCGATTATCTCGAGATAATCGACGGAGCGCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001014995.1-2813s21c1
Sequence:CCGGGATATTCCAGGGCACTGTATGCTCGAGCATACAGTGCCCTGGAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014995.1-627s21c1
Sequence:CCGGTCTTGGGCATCCTGGTGATAACTCGAGTTATCACCAGGATGCCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014995
FAM189B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 189, member B
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196131    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014995.1-2550s1c1
Sequence:CCGGGCCCATAAGCATTAGCTGGTTCTCGAGAACCAGCTAATGCTTATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014995.1-1887s1c1
Sequence:CCGGGCTTCAGTGATAGCTCAGGTTCTCGAGAACCTGAGCTATCACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014995.1-808s1c1
Sequence:CCGGGCTCTGTGTCATGCTTAGCATCTCGAGATGCTAAGCATGACACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014995.1-1286s1c1
Sequence:CCGGGATGCACAAAGCATCACGTATCTCGAGATACGTGATGCTTTGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014995.1-2849s1c1
Sequence:CCGGGTGTTTAAGAACACGGCGATTCTCGAGAATCGCCGTGTTCTTAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014995.1-1036s1c1
Sequence:CCGGCCTTACCATTTGTGCTGCAATCTCGAGATTGCAGCACAAATGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014995.1-2551s1c1
Sequence:CCGGCCCATAAGCATTAGCTGGTTACTCGAGTAACCAGCTAATGCTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014995.1-2012s21c1
Sequence:CCGGGCTGACTTCAGGGACCTTTATCTCGAGATAAAGGTCCCTGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014995.1-2310s21c1
Sequence:CCGGGAACTGGAGCCCATGGATATACTCGAGTATATCCATGGGCTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014995.1-1565s21c1
Sequence:CCGGTCTGTGCGCTCCGTCGATTATCTCGAGATAATCGACGGAGCGCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001014995.1-2813s21c1
Sequence:CCGGGATATTCCAGGGCACTGTATGCTCGAGCATACAGTGCCCTGGAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014995.1-627s21c1
Sequence:CCGGTCTTGGGCATCCTGGTGATAACTCGAGTTATCACCAGGATGCCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks