EMAIL THIS PAGE TO A FRIEND

FAM192A

family with sequence similarity 192, member A

68 Gene Product Result for
Synonyms: C16orf94 CDA018 NIP30
UniProtKB ID: Q9GZU8
Gene ID:
Mouse(102122) family with sequence similarity 192, member A
Zebrafish(334752) family with sequence similarity 192, member A
cow(534394) family with sequence similarity 192, member A
domestic cat(101083639) family with sequence similarity 192, member A
dog(478114) family with sequence similarity 192, member A
chicken(415647) family with sequence similarity 192, member A
sheep(101122209) family with sequence similarity 192, member A
domestic guinea pig(100725039) family with sequence similarity 192, member A
naked mole-rat(101700137) family with sequence similarity 192, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028221 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028221 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028221 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024946 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024946 Rosetta Predictions human pricing
NM_028221 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024861 predicted 617
2 SASI_Hs02_00357594 predicted 513
3 SASI_Hs01_00024864 predicted 658
4 SASI_Hs02_00357595 predicted 621
5 SASI_Hs02_00357596 predicted 1497
6 SASI_Hs01_00024868 predicted 606
7 SASI_Hs02_00357597 predicted 610
8 SASI_Hs02_00357598 predicted 668
9 SASI_Hs02_00357599 predicted 609
10 SASI_Hs02_00357600 predicted 625
11 SASI_Hs01_00024859 predicted 488
12 SASI_Hs01_00024860 predicted 415
13 SASI_Hs01_00024862 predicted 1326
14 SASI_Hs01_00024863 predicted 1307
15 SASI_Hs01_00024865 predicted 1402
16 SASI_Hs01_00024866 predicted 1393
17 SASI_Hs01_00024867 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178239 predicted 472
2 SASI_Mm02_00333547 predicted 1028
3 SASI_Mm01_00178240 predicted 537
4 SASI_Mm01_00178241 predicted 344
5 SASI_Mm02_00333548 predicted 1042
6 SASI_Mm02_00333549 predicted 590
7 SASI_Mm01_00178244 predicted 677
8 SASI_Mm01_00178246 predicted 1292
9 SASI_Mm01_00178247 predicted 669
10 SASI_Mm01_00178248 predicted 571
11 SASI_Mm01_00178242 predicted 1354
12 SASI_Mm01_00178243 predicted 1356
13 SASI_Mm01_00178245 predicted 491
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028221
VALIDATED
FAM192A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 192, member A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028221.4-1095s21c1
Sequence:CCGGGCACCCTAGCTCCTGATATTACTCGAGTAATATCAGGAGCTAGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028221.4-733s21c1
Sequence:CCGGAGAAGAAGCTGGCCGTGAAACCTCGAGGTTTCACGGCCAGCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028221.4-541s21c1
Sequence:CCGGAGTATGAGGAGCAATTCAAATCTCGAGATTTGAATTGCTCCTCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028221.4-691s21c1
Sequence:CCGGATCTCAACAAGGTTGGAATTTCTCGAGAAATTCCAACCTTGTTGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028221.4-1294s21c1
Sequence:CCGGCCAAACCTGTCCCATTGATATCTCGAGATATCAATGGGACAGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028221.2-990s1c1
Sequence:CCGGCATCAATGCTACAGGGAAGATCTCGAGATCTTCCCTGTAGCATTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028221.2-782s1c1
Sequence:CCGGGCAATAGTGTGAAGAGACTGACTCGAGTCAGTCTCTTCACACTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028221.2-1784s1c1
Sequence:CCGGCCAGAAACTATAACTGCTGATCTCGAGATCAGCAGTTATAGTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028221.2-754s1c1
Sequence:CCGGGCTGTGAAACATAAGAGCTCACTCGAGTGAGCTCTTATGTTTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028221.2-526s1c1
Sequence:CCGGGTAAGAGGGTTAGACGAAGATCTCGAGATCTTCGTCTAACCCTCTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028221
VALIDATED
FAM192A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 192, member A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028221.4-1095s21c1
Sequence:CCGGGCACCCTAGCTCCTGATATTACTCGAGTAATATCAGGAGCTAGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028221.4-733s21c1
Sequence:CCGGAGAAGAAGCTGGCCGTGAAACCTCGAGGTTTCACGGCCAGCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028221.4-541s21c1
Sequence:CCGGAGTATGAGGAGCAATTCAAATCTCGAGATTTGAATTGCTCCTCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028221.4-691s21c1
Sequence:CCGGATCTCAACAAGGTTGGAATTTCTCGAGAAATTCCAACCTTGTTGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028221.4-1294s21c1
Sequence:CCGGCCAAACCTGTCCCATTGATATCTCGAGATATCAATGGGACAGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028221.2-990s1c1
Sequence:CCGGCATCAATGCTACAGGGAAGATCTCGAGATCTTCCCTGTAGCATTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028221.2-782s1c1
Sequence:CCGGGCAATAGTGTGAAGAGACTGACTCGAGTCAGTCTCTTCACACTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028221.2-1784s1c1
Sequence:CCGGCCAGAAACTATAACTGCTGATCTCGAGATCAGCAGTTATAGTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028221.2-754s1c1
Sequence:CCGGGCTGTGAAACATAAGAGCTCACTCGAGTGAGCTCTTATGTTTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028221.2-526s1c1
Sequence:CCGGGTAAGAGGGTTAGACGAAGATCTCGAGATCTTCGTCTAACCCTCTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028221
VALIDATED
FAM192A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 192, member A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028221.4-1095s21c1
Sequence:CCGGGCACCCTAGCTCCTGATATTACTCGAGTAATATCAGGAGCTAGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028221.4-733s21c1
Sequence:CCGGAGAAGAAGCTGGCCGTGAAACCTCGAGGTTTCACGGCCAGCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028221.4-541s21c1
Sequence:CCGGAGTATGAGGAGCAATTCAAATCTCGAGATTTGAATTGCTCCTCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028221.4-691s21c1
Sequence:CCGGATCTCAACAAGGTTGGAATTTCTCGAGAAATTCCAACCTTGTTGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028221.4-1294s21c1
Sequence:CCGGCCAAACCTGTCCCATTGATATCTCGAGATATCAATGGGACAGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028221.2-990s1c1
Sequence:CCGGCATCAATGCTACAGGGAAGATCTCGAGATCTTCCCTGTAGCATTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028221.2-782s1c1
Sequence:CCGGGCAATAGTGTGAAGAGACTGACTCGAGTCAGTCTCTTCACACTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028221.2-1784s1c1
Sequence:CCGGCCAGAAACTATAACTGCTGATCTCGAGATCAGCAGTTATAGTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028221.2-754s1c1
Sequence:CCGGGCTGTGAAACATAAGAGCTCACTCGAGTGAGCTCTTATGTTTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028221.2-526s1c1
Sequence:CCGGGTAAGAGGGTTAGACGAAGATCTCGAGATCTTCGTCTAACCCTCTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024946
VALIDATED
FAM192A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 192, member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_024946.2-540s21c1
Sequence:CCGGCTCGACAGCAGGAACTAATAGCTCGAGCTATTAGTTCCTGCTGTCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_024946.2-612s21c1
Sequence:CCGGACCTCAAGAAGGTTGGAATTTCTCGAGAAATTCCAACCTTCTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024946.2-403s21c1
Sequence:CCGGTTATGACCCTCGATCTCTATACTCGAGTATAGAGATCGAGGGTCATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024946.2-1076s21c1
Sequence:CCGGCATGCTGCCTATAGGCATTATCTCGAGATAATGCCTATAGGCAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024946.2-462s21c1
Sequence:CCGGAGTACGAGGAACAGTTCAAATCTCGAGATTTGAACTGTTCCTCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024946.1-870s1c1
Sequence:CCGGCGGAAAGATTGTCTCCTCCATCTCGAGATGGAGGAGACAATCTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024946.1-1150s1c1
Sequence:CCGGGCCACTTTCCTCACTGATATTCTCGAGAATATCAGTGAGGAAAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024946.1-442s1c1
Sequence:CCGGCGACAGCAGGAACTAATAGAACTCGAGTTCTATTAGTTCCTGCTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024946.1-1869s1c1
Sequence:CCGGCCAGGACATCAAAGTCATCATCTCGAGATGATGACTTTGATGTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024946.1-366s1c1
Sequence:CCGGCGAGGAACAGTTCAAATTCAACTCGAGTTGAATTTGAACTGTTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024946
VALIDATED
FAM192A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 192, member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_024946.2-540s21c1
Sequence:CCGGCTCGACAGCAGGAACTAATAGCTCGAGCTATTAGTTCCTGCTGTCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_024946.2-612s21c1
Sequence:CCGGACCTCAAGAAGGTTGGAATTTCTCGAGAAATTCCAACCTTCTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024946.2-403s21c1
Sequence:CCGGTTATGACCCTCGATCTCTATACTCGAGTATAGAGATCGAGGGTCATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024946.2-1076s21c1
Sequence:CCGGCATGCTGCCTATAGGCATTATCTCGAGATAATGCCTATAGGCAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024946.2-462s21c1
Sequence:CCGGAGTACGAGGAACAGTTCAAATCTCGAGATTTGAACTGTTCCTCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024946.1-870s1c1
Sequence:CCGGCGGAAAGATTGTCTCCTCCATCTCGAGATGGAGGAGACAATCTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024946.1-1150s1c1
Sequence:CCGGGCCACTTTCCTCACTGATATTCTCGAGAATATCAGTGAGGAAAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024946.1-442s1c1
Sequence:CCGGCGACAGCAGGAACTAATAGAACTCGAGTTCTATTAGTTCCTGCTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024946.1-1869s1c1
Sequence:CCGGCCAGGACATCAAAGTCATCATCTCGAGATGATGACTTTGATGTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024946.1-366s1c1
Sequence:CCGGCGAGGAACAGTTCAAATTCAACTCGAGTTGAATTTGAACTGTTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024946
VALIDATED
FAM192A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 192, member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_024946.2-540s21c1
Sequence:CCGGCTCGACAGCAGGAACTAATAGCTCGAGCTATTAGTTCCTGCTGTCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_024946.2-612s21c1
Sequence:CCGGACCTCAAGAAGGTTGGAATTTCTCGAGAAATTCCAACCTTCTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024946.2-403s21c1
Sequence:CCGGTTATGACCCTCGATCTCTATACTCGAGTATAGAGATCGAGGGTCATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024946.2-1076s21c1
Sequence:CCGGCATGCTGCCTATAGGCATTATCTCGAGATAATGCCTATAGGCAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024946.2-462s21c1
Sequence:CCGGAGTACGAGGAACAGTTCAAATCTCGAGATTTGAACTGTTCCTCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024946.1-870s1c1
Sequence:CCGGCGGAAAGATTGTCTCCTCCATCTCGAGATGGAGGAGACAATCTTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024946.1-1150s1c1
Sequence:CCGGGCCACTTTCCTCACTGATATTCTCGAGAATATCAGTGAGGAAAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024946.1-442s1c1
Sequence:CCGGCGACAGCAGGAACTAATAGAACTCGAGTTCTATTAGTTCCTGCTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024946.1-1869s1c1
Sequence:CCGGCCAGGACATCAAAGTCATCATCTCGAGATGATGACTTTGATGTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024946.1-366s1c1
Sequence:CCGGCGAGGAACAGTTCAAATTCAACTCGAGTTGAATTTGAACTGTTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)