EMAIL THIS PAGE TO A FRIEND

FAM193A

family with sequence similarity 193, member A

82 Gene Product Result for
Synonyms: C4orf8
Gene ID:
Mouse(231128) family with sequence similarity 193, member A
Rat(305452) family with sequence similarity 193, member A
Zebrafish(564207) family with sequence similarity 193, member A
chicken(422885) family with sequence similarity 193, member A
dog(610546) family with sequence similarity 193, member A
cow(534755) family with sequence similarity 193, member A
domestic cat(101096981) family with sequence similarity 193, member A
naked mole-rat(101703580) family with sequence similarity 193, member A
domestic guinea pig(100734637) family with sequence similarity 193, member A
sheep(101101892) family with sequence similarity 193, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043116 Anti-FAM193A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003704 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001030306 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001030306 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001030306 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003704 Rosetta Predictions human pricing
XM_001059938 Rosetta Predictions rat pricing
XM_223536 Rosetta Predictions rat pricing
NM_001030306 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179095 predicted 1835
2 SASI_Hs01_00179096 predicted 3969
3 SASI_Hs01_00179097 predicted 1863
4 SASI_Hs01_00179098 predicted 1945
5 SASI_Hs01_00179099 predicted 3954
6 SASI_Hs02_00336119 predicted 1803
7 SASI_Hs01_00179100 predicted 876
8 SASI_Hs02_00336120 predicted 1374
9 SASI_Hs01_00179101 predicted 681
10 SASI_Hs01_00179102 predicted 2239
11 SASI_Hs01_00179103 predicted 2170
12 SASI_Hs01_00179104 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059938 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294863 predicted 564
2 SASI_Rn02_00294864 predicted 419
3 SASI_Rn02_00294865 predicted 310
4 SASI_Rn02_00294866 predicted 4226
5 SASI_Rn02_00294867 predicted 3709
6 SASI_Rn02_00294868 predicted 1526
7 SASI_Rn02_00294869 predicted 501
8 SASI_Rn02_00294870 predicted 1288
9 SASI_Rn02_00294871 predicted 1441
10 SASI_Rn02_00294872 predicted 1540
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381497 predicted 558
2 SASI_Rn02_00381498 predicted 412
3 SASI_Rn02_00381499 predicted 312
4 SASI_Rn02_00381500 predicted 4233
5 SASI_Rn02_00381501 predicted 3712
6 SASI_Rn02_00381502 predicted 1528
7 SASI_Rn02_00381503 predicted 502
8 SASI_Rn02_00381504 predicted 1284
9 SASI_Rn02_00381505 predicted 1441
10 SASI_Rn02_00381506 predicted 1538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288132 predicted 3802
2 SASI_Mm02_00288133 predicted 1390
3 SASI_Mm01_00126037 predicted 722
4 SASI_Mm01_00126039 predicted 3813
5 SASI_Mm01_00126041 predicted 3092
6 SASI_Mm01_00126042 predicted 1102
7 SASI_Mm01_00126044 predicted 3056
8 SASI_Mm01_00126045 predicted 2240
9 SASI_Mm02_00288134 predicted 3239
10 SASI_Mm02_00288135 predicted 1397
11 SASI_Mm01_00126038 predicted 2087
12 SASI_Mm01_00126040 predicted 3113
13 SASI_Mm01_00126043 predicted 1017
14 SASI_Mm01_00126046 predicted 1093
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003704
FAM193A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 193, member A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003704.2-597s1c1
Sequence:CCGGGCCACTTCTTCAGAGCAACTTCTCGAGAAGTTGCTCTGAAGAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003704.2-2272s1c1
Sequence:CCGGCCTTCAGTAGGTGACGTGTTTCTCGAGAAACACGTCACCTACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003704.2-1878s1c1
Sequence:CCGGCCATATTTATCCGAGCTGTTTCTCGAGAAACAGCTCGGATAAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003704.3-3455s21c1
Sequence:CCGGACATCATGCAGCACCATAAAGCTCGAGCTTTATGGTGCTGCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003704.3-1865s21c1
Sequence:CCGGCATCTCTTCAAGACCATATTTCTCGAGAAATATGGTCTTGAAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003704.3-3972s21c1
Sequence:CCGGGTCTATCAACTGGTCCAATTTCTCGAGAAATTGGACCAGTTGATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003704.3-1256s21c1
Sequence:CCGGCAGCCAAATTTGCTGATATTTCTCGAGAAATATCAGCAAATTTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003704.3-4492s21c1
Sequence:CCGGGTGTACACGTTGCGCTGTTTGCTCGAGCAAACAGCGCAACGTGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003704
FAM193A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 193, member A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003704.2-597s1c1
Sequence:CCGGGCCACTTCTTCAGAGCAACTTCTCGAGAAGTTGCTCTGAAGAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003704.2-2272s1c1
Sequence:CCGGCCTTCAGTAGGTGACGTGTTTCTCGAGAAACACGTCACCTACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003704.2-1878s1c1
Sequence:CCGGCCATATTTATCCGAGCTGTTTCTCGAGAAACAGCTCGGATAAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003704.3-3455s21c1
Sequence:CCGGACATCATGCAGCACCATAAAGCTCGAGCTTTATGGTGCTGCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003704.3-1865s21c1
Sequence:CCGGCATCTCTTCAAGACCATATTTCTCGAGAAATATGGTCTTGAAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003704.3-3972s21c1
Sequence:CCGGGTCTATCAACTGGTCCAATTTCTCGAGAAATTGGACCAGTTGATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003704.3-1256s21c1
Sequence:CCGGCAGCCAAATTTGCTGATATTTCTCGAGAAATATCAGCAAATTTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003704.3-4492s21c1
Sequence:CCGGGTGTACACGTTGCGCTGTTTGCTCGAGCAAACAGCGCAACGTGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003704
FAM193A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 193, member A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003704.2-597s1c1
Sequence:CCGGGCCACTTCTTCAGAGCAACTTCTCGAGAAGTTGCTCTGAAGAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003704.2-2272s1c1
Sequence:CCGGCCTTCAGTAGGTGACGTGTTTCTCGAGAAACACGTCACCTACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003704.2-1878s1c1
Sequence:CCGGCCATATTTATCCGAGCTGTTTCTCGAGAAACAGCTCGGATAAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003704.3-3455s21c1
Sequence:CCGGACATCATGCAGCACCATAAAGCTCGAGCTTTATGGTGCTGCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003704.3-1865s21c1
Sequence:CCGGCATCTCTTCAAGACCATATTTCTCGAGAAATATGGTCTTGAAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003704.3-3972s21c1
Sequence:CCGGGTCTATCAACTGGTCCAATTTCTCGAGAAATTGGACCAGTTGATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003704.3-1256s21c1
Sequence:CCGGCAGCCAAATTTGCTGATATTTCTCGAGAAATATCAGCAAATTTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003704.3-4492s21c1
Sequence:CCGGGTGTACACGTTGCGCTGTTTGCTCGAGCAAACAGCGCAACGTGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001030306
VALIDATED
FAM193A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 193, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030306.1-1101s21c1
Sequence:CCGGGTTGACCAACTACGATGATACCTCGAGGTATCATCGTAGTTGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030306.1-3747s21c1
Sequence:CCGGTGAGCGGGAGGTGGAGTATTTCTCGAGAAATACTCCACCTCCCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030306.1-4397s21c1
Sequence:CCGGTTGCAGAATGAGAACGTTAAACTCGAGTTTAACGTTCTCATTCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030306.1-3815s21c1
Sequence:CCGGCCATCAACTGGTCCAACTTTACTCGAGTAAAGTTGGACCAGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030306.1-1685s21c1
Sequence:CCGGCATCTCTTCAAGACCATATTTCTCGAGAAATATGGTCTTGAAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001030306
VALIDATED
FAM193A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 193, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030306.1-1101s21c1
Sequence:CCGGGTTGACCAACTACGATGATACCTCGAGGTATCATCGTAGTTGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030306.1-3747s21c1
Sequence:CCGGTGAGCGGGAGGTGGAGTATTTCTCGAGAAATACTCCACCTCCCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030306.1-4397s21c1
Sequence:CCGGTTGCAGAATGAGAACGTTAAACTCGAGTTTAACGTTCTCATTCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030306.1-3815s21c1
Sequence:CCGGCCATCAACTGGTCCAACTTTACTCGAGTAAAGTTGGACCAGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030306.1-1685s21c1
Sequence:CCGGCATCTCTTCAAGACCATATTTCTCGAGAAATATGGTCTTGAAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001030306
VALIDATED
FAM193A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 193, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030306.1-1101s21c1
Sequence:CCGGGTTGACCAACTACGATGATACCTCGAGGTATCATCGTAGTTGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030306.1-3747s21c1
Sequence:CCGGTGAGCGGGAGGTGGAGTATTTCTCGAGAAATACTCCACCTCCCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030306.1-4397s21c1
Sequence:CCGGTTGCAGAATGAGAACGTTAAACTCGAGTTTAACGTTCTCATTCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030306.1-3815s21c1
Sequence:CCGGCCATCAACTGGTCCAACTTTACTCGAGTAAAGTTGGACCAGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030306.1-1685s21c1
Sequence:CCGGCATCTCTTCAAGACCATATTTCTCGAGAAATATGGTCTTGAAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks