EMAIL THIS PAGE TO A FRIEND

FAM193B

family with sequence similarity 193, member B

64 Gene Product Result for
Synonyms: IRIZIO
UniProtKB ID: Q96PV7, E9PET5, Q9NW00
Gene ID:
Mouse(212483) family with sequence similarity 193, member B
Rat(498703) family with sequence similarity 193, member B
sheep(101102560) family with sequence similarity 193, member B
domestic guinea pig(100713851) family with sequence similarity 193, member B
naked mole-rat(101713737) family with sequence similarity 193, member B
Zebrafish(569234) family with sequence similarity 193, member B
chicken(416216) family with sequence similarity 193, member B
cow(538655) family with sequence similarity 193, member B
domestic cat(101098193) family with sequence similarity 193, member B
dog(479273) family with sequence similarity 193, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019057 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019057 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019057 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145382 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145382 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145382 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019057 Rosetta Predictions human pricing
XM_001069211 Rosetta Predictions rat pricing
XM_573985 Rosetta Predictions rat pricing
NM_145382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145308 predicted 2799
2 SASI_Hs02_00352638 predicted 3903
3 SASI_Hs02_00352639 predicted 2416
4 SASI_Hs01_00145309 predicted 3884
5 SASI_Hs01_00145310 predicted 2977
6 SASI_Hs02_00352640 predicted 3910
7 SASI_Hs01_00145311 predicted 3006
8 SASI_Hs01_00145312 predicted 3243
9 SASI_Hs02_00352641 predicted 2775
10 SASI_Hs01_00145313 predicted 3881
11 SASI_Hs01_00145314 predicted 4162
12 SASI_Hs01_00145315 predicted 3214
13 SASI_Hs01_00145316 predicted 3231
14 SASI_Hs01_00145317 predicted 3487
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327273 predicted 693
2 SASI_Rn02_00327274 predicted 2707
3 SASI_Rn02_00327275 predicted 1740
4 SASI_Rn02_00327276 predicted 2139
5 SASI_Rn02_00327277 predicted 1939
6 SASI_Rn02_00327278 predicted 2431
7 SASI_Rn02_00327279 predicted 1928
8 SASI_Rn02_00327280 predicted 1713
9 SASI_Rn02_00327281 predicted 1249
10 SASI_Rn02_00327282 predicted 2230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573985 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401160 predicted 2646
2 SASI_Rn02_00401161 predicted 2584
3 SASI_Rn02_00401162 predicted 1917
4 SASI_Rn02_00401163 predicted 1734
5 SASI_Rn02_00401164 predicted 2594
6 SASI_Rn02_00401165 predicted 2345
7 SASI_Rn02_00401166 predicted 2615
8 SASI_Rn02_00401167 predicted 1670
9 SASI_Rn02_00401168 predicted 1794
10 SASI_Rn02_00401169 predicted 1817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340695 predicted 3604
2 SASI_Mm01_00117087 predicted 3881
3 SASI_Mm01_00117088 predicted 2790
4 SASI_Mm02_00340696 predicted 2911
5 SASI_Mm02_00340697 predicted 3035
6 SASI_Mm02_00340698 predicted 2415
7 SASI_Mm02_00340699 predicted 3229
8 SASI_Mm02_00340700 predicted 3212
9 SASI_Mm02_00340701 predicted 3041
10 SASI_Mm02_00340702 predicted 2495
11 SASI_Mm01_00117079 predicted 1782
12 SASI_Mm01_00117080 predicted 1146
13 SASI_Mm01_00117081 predicted 1454
14 SASI_Mm01_00117082 predicted 1163
15 SASI_Mm01_00117083 predicted 1459
16 SASI_Mm01_00117084 predicted 1902
17 SASI_Mm01_00117085 predicted 2078
18 SASI_Mm01_00117086 predicted 1518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019057
VALIDATED
FAM193B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 193, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019057.3-1838s21c1
Sequence:CCGGCTCGTTCCTGTCGGCACATAACTCGAGTTATGTGCCGACAGGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019057.3-1739s21c1
Sequence:CCGGTTGTGGAGATGACTCTCATTCCTCGAGGAATGAGAGTCATCTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019057.3-4006s21c1
Sequence:CCGGTGCCAGCTGAAGGCGTATAATCTCGAGATTATACGCCTTCAGCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019057.3-1711s21c1
Sequence:CCGGTGTCACACACATCCTGCAAATCTCGAGATTTGCAGGATGTGTGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_019057.2-3581s1c1
Sequence:CCGGGCTCAAAGGAAGTTCCCAGTTCTCGAGAACTGGGAACTTCCTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019057.2-4104s1c1
Sequence:CCGGGTACTTTAAGAGGTTCTGTTTCTCGAGAAACAGAACCTCTTAAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019057.2-3046s1c1
Sequence:CCGGGAAGCTCTAAAGCAGGCAAATCTCGAGATTTGCCTGCTTTAGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019057.2-3772s1c1
Sequence:CCGGGTCCTAGAGCTTCCCAAAGTACTCGAGTACTTTGGGAAGCTCTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019057.2-4132s1c1
Sequence:CCGGGCAAAGCAGACTCGTCAGAAACTCGAGTTTCTGACGAGTCTGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019057
VALIDATED
FAM193B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 193, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019057.3-1838s21c1
Sequence:CCGGCTCGTTCCTGTCGGCACATAACTCGAGTTATGTGCCGACAGGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019057.3-1739s21c1
Sequence:CCGGTTGTGGAGATGACTCTCATTCCTCGAGGAATGAGAGTCATCTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019057.3-4006s21c1
Sequence:CCGGTGCCAGCTGAAGGCGTATAATCTCGAGATTATACGCCTTCAGCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019057.3-1711s21c1
Sequence:CCGGTGTCACACACATCCTGCAAATCTCGAGATTTGCAGGATGTGTGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_019057.2-3581s1c1
Sequence:CCGGGCTCAAAGGAAGTTCCCAGTTCTCGAGAACTGGGAACTTCCTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019057.2-4104s1c1
Sequence:CCGGGTACTTTAAGAGGTTCTGTTTCTCGAGAAACAGAACCTCTTAAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019057.2-3046s1c1
Sequence:CCGGGAAGCTCTAAAGCAGGCAAATCTCGAGATTTGCCTGCTTTAGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019057.2-3772s1c1
Sequence:CCGGGTCCTAGAGCTTCCCAAAGTACTCGAGTACTTTGGGAAGCTCTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019057.2-4132s1c1
Sequence:CCGGGCAAAGCAGACTCGTCAGAAACTCGAGTTTCTGACGAGTCTGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019057
VALIDATED
FAM193B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 193, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019057.3-1838s21c1
Sequence:CCGGCTCGTTCCTGTCGGCACATAACTCGAGTTATGTGCCGACAGGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019057.3-1739s21c1
Sequence:CCGGTTGTGGAGATGACTCTCATTCCTCGAGGAATGAGAGTCATCTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019057.3-4006s21c1
Sequence:CCGGTGCCAGCTGAAGGCGTATAATCTCGAGATTATACGCCTTCAGCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019057.3-1711s21c1
Sequence:CCGGTGTCACACACATCCTGCAAATCTCGAGATTTGCAGGATGTGTGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_019057.2-3581s1c1
Sequence:CCGGGCTCAAAGGAAGTTCCCAGTTCTCGAGAACTGGGAACTTCCTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019057.2-4104s1c1
Sequence:CCGGGTACTTTAAGAGGTTCTGTTTCTCGAGAAACAGAACCTCTTAAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019057.2-3046s1c1
Sequence:CCGGGAAGCTCTAAAGCAGGCAAATCTCGAGATTTGCCTGCTTTAGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019057.2-3772s1c1
Sequence:CCGGGTCCTAGAGCTTCCCAAAGTACTCGAGTACTTTGGGAAGCTCTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019057.2-4132s1c1
Sequence:CCGGGCAAAGCAGACTCGTCAGAAACTCGAGTTTCTGACGAGTCTGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145382
VALIDATED
FAM193B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 193, member B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000121505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145382.2-926s1c1
Sequence:CCGGCTGAAGCAGGTGAATCGTGTTCTCGAGAACACGATTCACCTGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145382.2-1425s1c1
Sequence:CCGGACCCAAGCTCTGAGGAAAGTTCTCGAGAACTTTCCTCAGAGCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145382.2-1990s1c1
Sequence:CCGGTGCAAAGCAAACTCGTCAGAACTCGAGTTCTGACGAGTTTGCTTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145382.2-1991s1c1
Sequence:CCGGGCAAAGCAAACTCGTCAGAAACTCGAGTTTCTGACGAGTTTGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145382
VALIDATED
FAM193B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 193, member B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000121505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145382.2-926s1c1
Sequence:CCGGCTGAAGCAGGTGAATCGTGTTCTCGAGAACACGATTCACCTGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145382.2-1425s1c1
Sequence:CCGGACCCAAGCTCTGAGGAAAGTTCTCGAGAACTTTCCTCAGAGCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145382.2-1990s1c1
Sequence:CCGGTGCAAAGCAAACTCGTCAGAACTCGAGTTCTGACGAGTTTGCTTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145382.2-1991s1c1
Sequence:CCGGGCAAAGCAAACTCGTCAGAAACTCGAGTTTCTGACGAGTTTGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145382
VALIDATED
FAM193B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 193, member B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000121505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145382.2-926s1c1
Sequence:CCGGCTGAAGCAGGTGAATCGTGTTCTCGAGAACACGATTCACCTGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145382.2-1425s1c1
Sequence:CCGGACCCAAGCTCTGAGGAAAGTTCTCGAGAACTTTCCTCAGAGCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145382.2-1990s1c1
Sequence:CCGGTGCAAAGCAAACTCGTCAGAACTCGAGTTCTGACGAGTTTGCTTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145382.2-1991s1c1
Sequence:CCGGGCAAAGCAAACTCGTCAGAAACTCGAGTTTCTGACGAGTTTGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks