EMAIL THIS PAGE TO A FRIEND

FAM194A

family with sequence similarity 194, member A

58 Gene Product Result for
Synonyms: C3orf44
UniProtKB ID: Q7L0X2, Q8N9Y8, Q8NCQ6, Q8NCZ6
Gene ID:
Mouse(545527) family with sequence similarity 194, member A
Rat(499626) family with sequence similarity 194, member A
chicken(771833) family with sequence similarity 194, member A
cow(617569) family with sequence similarity 194, member A
cow(100335773) family with sequence similarity 194, member A
domestic cat(101097585) family with sequence similarity 194, member A
dog(485714) family with sequence similarity 194, member A
naked mole-rat(101707131) family with sequence similarity 194, member A
domestic guinea pig(100721455) family with sequence similarity 194, member A
sheep(101102033) family with sequence similarity 194, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152394 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081262 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081262 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081262 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152394 Rosetta Predictions human pricing
NM_001024300 Rosetta Predictions rat pricing
NM_001081262 Rosetta Predictions mouse pricing
XM_619904 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087509 predicted 1537
2 SASI_Hs01_00087510 predicted 1756
3 SASI_Hs01_00087512 predicted 1315
4 SASI_Hs01_00087513 predicted 1430
5 SASI_Hs01_00087514 predicted 1309
6 SASI_Hs01_00087517 predicted 602
7 SASI_Hs02_00366067 predicted 1583
8 SASI_Hs02_00366068 predicted 1047
9 SASI_Hs02_00366069 predicted 906
10 SASI_Hs02_00366070 predicted 495
11 SASI_Hs01_00087511 predicted 1230
12 SASI_Hs01_00087515 predicted 1600
13 SASI_Hs01_00087516 predicted 1333
14 SASI_Hs01_00087518 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024300 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102363 predicted 1667
2 SASI_Rn01_00102365 predicted 1146
3 SASI_Rn01_00102366 predicted 1106
4 SASI_Rn02_00202495 predicted 422
5 SASI_Rn02_00202496 predicted 1098
6 SASI_Rn01_00102368 predicted 519
7 SASI_Rn01_00102369 predicted 1395
8 SASI_Rn01_00102370 predicted 721
9 SASI_Rn01_00102371 predicted 471
10 SASI_Rn01_00102372 predicted 1341
11 SASI_Rn01_00102364 predicted 1422
12 SASI_Rn01_00102367 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081262 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296747 predicted 1631
2 SASI_Mm02_00296748 predicted 1887
3 SASI_Mm02_00296749 predicted 931
4 SASI_Mm02_00296750 predicted 1186
5 SASI_Mm02_00296751 predicted 990
6 SASI_Mm02_00296752 predicted 1416
7 SASI_Mm02_00296753 predicted 1286
8 SASI_Mm02_00296754 predicted 1746
9 SASI_Mm02_00296755 predicted 1425
10 SASI_Mm02_00296756 predicted 1673
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272356 predicted 1637
2 SASI_Mm01_00272357 predicted 1894
3 SASI_Mm01_00272358 predicted 936
4 SASI_Mm01_00272359 predicted 996
5 SASI_Mm01_00272360 predicted 1287
6 SASI_Mm01_00272361 predicted 1744
7 SASI_Mm01_00272362 predicted 1433
8 SASI_Mm01_00272363 predicted 1891
9 SASI_Mm01_00272364 predicted 1674
10 SASI_Mm01_00272365 predicted 1630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152394
FAM194A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 194, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152394.2-1686s1c1
Sequence:CCGGCCGTTATATTGGAGTCCGCATCTCGAGATGCGGACTCCAATATAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152394.2-1849s1c1
Sequence:CCGGGCCAGTTTAATAAAGATCCGTCTCGAGACGGATCTTTATTAAACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152394.2-685s1c1
Sequence:CCGGCCAGAAGAGTCGAAACTAAATCTCGAGATTTAGTTTCGACTCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152394.2-1542s1c1
Sequence:CCGGCAATGGAAATGTCTGGGTATACTCGAGTATACCCAGACATTTCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152394.2-1703s1c1
Sequence:CCGGGCATCTTAGAACAAGACAAGACTCGAGTCTTGTCTTGTTCTAAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152394.2-1162s1c1
Sequence:CCGGGAAGATGATTCAAAGCGCTTACTCGAGTAAGCGCTTTGAATCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152394.2-1541s1c1
Sequence:CCGGCCAATGGAAATGTCTGGGTATCTCGAGATACCCAGACATTTCCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152394.2-751s1c1
Sequence:CCGGGAGCCTTCTCTAAGAACGTTACTCGAGTAACGTTCTTAGAGAAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152394.2-1529s1c1
Sequence:CCGGCCTGCTATCATCCCAATGGAACTCGAGTTCCATTGGGATGATAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152394
FAM194A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 194, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152394.2-1686s1c1
Sequence:CCGGCCGTTATATTGGAGTCCGCATCTCGAGATGCGGACTCCAATATAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152394.2-1849s1c1
Sequence:CCGGGCCAGTTTAATAAAGATCCGTCTCGAGACGGATCTTTATTAAACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152394.2-685s1c1
Sequence:CCGGCCAGAAGAGTCGAAACTAAATCTCGAGATTTAGTTTCGACTCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152394.2-1542s1c1
Sequence:CCGGCAATGGAAATGTCTGGGTATACTCGAGTATACCCAGACATTTCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152394.2-1703s1c1
Sequence:CCGGGCATCTTAGAACAAGACAAGACTCGAGTCTTGTCTTGTTCTAAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152394.2-1162s1c1
Sequence:CCGGGAAGATGATTCAAAGCGCTTACTCGAGTAAGCGCTTTGAATCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152394.2-1541s1c1
Sequence:CCGGCCAATGGAAATGTCTGGGTATCTCGAGATACCCAGACATTTCCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152394.2-751s1c1
Sequence:CCGGGAGCCTTCTCTAAGAACGTTACTCGAGTAACGTTCTTAGAGAAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152394.2-1529s1c1
Sequence:CCGGCCTGCTATCATCCCAATGGAACTCGAGTTCCATTGGGATGATAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152394
FAM194A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 194, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152394.2-1686s1c1
Sequence:CCGGCCGTTATATTGGAGTCCGCATCTCGAGATGCGGACTCCAATATAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152394.2-1849s1c1
Sequence:CCGGGCCAGTTTAATAAAGATCCGTCTCGAGACGGATCTTTATTAAACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152394.2-685s1c1
Sequence:CCGGCCAGAAGAGTCGAAACTAAATCTCGAGATTTAGTTTCGACTCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152394.2-1542s1c1
Sequence:CCGGCAATGGAAATGTCTGGGTATACTCGAGTATACCCAGACATTTCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152394.2-1703s1c1
Sequence:CCGGGCATCTTAGAACAAGACAAGACTCGAGTCTTGTCTTGTTCTAAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152394.2-1162s1c1
Sequence:CCGGGAAGATGATTCAAAGCGCTTACTCGAGTAAGCGCTTTGAATCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152394.2-1541s1c1
Sequence:CCGGCCAATGGAAATGTCTGGGTATCTCGAGATACCCAGACATTTCCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152394.2-751s1c1
Sequence:CCGGGAGCCTTCTCTAAGAACGTTACTCGAGTAACGTTCTTAGAGAAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152394.2-1529s1c1
Sequence:CCGGCCTGCTATCATCCCAATGGAACTCGAGTTCCATTGGGATGATAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081262
FAM194A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 194, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081262.1-1852s21c1
Sequence:CCGGAGACAAGGTCTCCATTAATTTCTCGAGAAATTAATGGAGACCTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081262.1-1689s21c1
Sequence:CCGGTCTGGGTATACATCAACATACCTCGAGGTATGTTGATGTATACCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081262.1-1999s21c1
Sequence:CCGGGATCCGGCGATTGTTCAATAACTCGAGTTATTGAACAATCGCCGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081262.1-1974s21c1
Sequence:CCGGTTCTGCTGTTGGCCAACTTAACTCGAGTTAAGTTGGCCAACAGCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081262.1-1812s21c1
Sequence:CCGGTGGCTTTGAACCGTTACATTGCTCGAGCAATGTAACGGTTCAAAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081262
FAM194A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 194, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081262.1-1852s21c1
Sequence:CCGGAGACAAGGTCTCCATTAATTTCTCGAGAAATTAATGGAGACCTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081262.1-1689s21c1
Sequence:CCGGTCTGGGTATACATCAACATACCTCGAGGTATGTTGATGTATACCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081262.1-1999s21c1
Sequence:CCGGGATCCGGCGATTGTTCAATAACTCGAGTTATTGAACAATCGCCGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081262.1-1974s21c1
Sequence:CCGGTTCTGCTGTTGGCCAACTTAACTCGAGTTAAGTTGGCCAACAGCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081262.1-1812s21c1
Sequence:CCGGTGGCTTTGAACCGTTACATTGCTCGAGCAATGTAACGGTTCAAAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081262
FAM194A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 194, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081262.1-1852s21c1
Sequence:CCGGAGACAAGGTCTCCATTAATTTCTCGAGAAATTAATGGAGACCTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081262.1-1689s21c1
Sequence:CCGGTCTGGGTATACATCAACATACCTCGAGGTATGTTGATGTATACCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081262.1-1999s21c1
Sequence:CCGGGATCCGGCGATTGTTCAATAACTCGAGTTATTGAACAATCGCCGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081262.1-1974s21c1
Sequence:CCGGTTCTGCTGTTGGCCAACTTAACTCGAGTTAAGTTGGCCAACAGCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081262.1-1812s21c1
Sequence:CCGGTGGCTTTGAACCGTTACATTGCTCGAGCAATGTAACGGTTCAAAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)