EMAIL THIS PAGE TO A FRIEND

FAM195A

family with sequence similarity 195, member A

64 Gene Product Result for
Synonyms: C16orf14 c349E10.1
UniProtKB ID: Q9BUT9, Q969E9, Q96KV8
Gene ID:
Mouse(68241) family with sequence similarity 195, member A
Rat(685545) family with sequence similarity 195, member A
chicken(425184) family with sequence similarity 195, member A
cow(618020) family with sequence similarity 195, member A
domestic cat(101093825) family with sequence similarity 195, member A
naked mole-rat(101696526) family with sequence similarity 195, member A
domestic guinea pig(100716119) family with sequence similarity 195, member A
sheep(101103115) family with sequence similarity 195, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA060363 Anti-FAM195A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138418 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138418 Rosetta Predictions human pricing
NM_001109475 Rosetta Predictions rat pricing
NM_026633 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036527 predicted 584
2 SASI_Hs01_00036528 predicted 658
3 SASI_Hs01_00036531 predicted 655
4 SASI_Hs01_00036532 predicted 551
5 SASI_Hs01_00036533 predicted 588
6 SASI_Hs01_00036534 predicted 500
7 SASI_Hs01_00036535 predicted 650
8 SASI_Hs02_00363557 predicted 578
9 SASI_Hs01_00036526 predicted 600
10 SASI_Hs02_00363558 predicted 329
11 SASI_Hs01_00036529 predicted 613
12 SASI_Hs01_00036530 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109475 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248759 predicted 357
2 SASI_Rn02_00248760 predicted 258
3 SASI_Rn02_00248761 predicted 460
4 SASI_Rn02_00248762 predicted 348
5 SASI_Rn02_00248763 predicted 250
6 SASI_Rn02_00248764 predicted 324
7 SASI_Rn02_00248765 predicted 327
8 SASI_Rn02_00248766 predicted 202
9 SASI_Rn02_00248767 predicted 382
10 SASI_Rn02_00248768 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069138 predicted 567
2 SASI_Mm01_00069139 predicted 347
3 SASI_Mm01_00069140 predicted 251
4 SASI_Mm02_00330611 predicted 229
5 SASI_Mm01_00069141 predicted 461
6 SASI_Mm01_00069142 predicted 462
7 SASI_Mm01_00069143 predicted 344
8 SASI_Mm01_00069144 predicted 557
9 SASI_Mm01_00069145 predicted 479
10 SASI_Mm01_00069147 predicted 324
11 SASI_Mm01_00069146 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138418
VALIDATED
FAM195A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 195, member A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138418.2-554s1c1
Sequence:CCGGGAACTTTGTGCCCATTGACCTCTCGAGAGGTCAATGGGCACAAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138418.2-338s1c1
Sequence:CCGGGCTTGTGTTCAATCGTGTGAACTCGAGTTCACACGATTGAACACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_138418.2-724s21c1
Sequence:CCGGCACCTGAAGTGCCAGCATTTGCTCGAGCAAATGCTGGCACTTCAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_138418.2-551s21c1
Sequence:CCGGGCAGAACTTTGTGCCCATTGACTCGAGTCAATGGGCACAAAGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_138418.2-331s21c1
Sequence:CCGGGGCCAAGGCTTGTGTTCAATCCTCGAGGATTGAACACAAGCCTTGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_138418.2-424s21c1
Sequence:CCGGACGAGGAGAATGTCCGCTTTGCTCGAGCAAAGCGGACATTCTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_138418.2-591s21c1
Sequence:CCGGCAGCAGTTCCTGGCGAGAATCCTCGAGGATTCTCGCCAGGAACTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138418
VALIDATED
FAM195A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 195, member A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138418.2-554s1c1
Sequence:CCGGGAACTTTGTGCCCATTGACCTCTCGAGAGGTCAATGGGCACAAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138418.2-338s1c1
Sequence:CCGGGCTTGTGTTCAATCGTGTGAACTCGAGTTCACACGATTGAACACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_138418.2-724s21c1
Sequence:CCGGCACCTGAAGTGCCAGCATTTGCTCGAGCAAATGCTGGCACTTCAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_138418.2-551s21c1
Sequence:CCGGGCAGAACTTTGTGCCCATTGACTCGAGTCAATGGGCACAAAGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_138418.2-331s21c1
Sequence:CCGGGGCCAAGGCTTGTGTTCAATCCTCGAGGATTGAACACAAGCCTTGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_138418.2-424s21c1
Sequence:CCGGACGAGGAGAATGTCCGCTTTGCTCGAGCAAAGCGGACATTCTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_138418.2-591s21c1
Sequence:CCGGCAGCAGTTCCTGGCGAGAATCCTCGAGGATTCTCGCCAGGAACTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138418
VALIDATED
FAM195A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 195, member A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138418.2-554s1c1
Sequence:CCGGGAACTTTGTGCCCATTGACCTCTCGAGAGGTCAATGGGCACAAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138418.2-338s1c1
Sequence:CCGGGCTTGTGTTCAATCGTGTGAACTCGAGTTCACACGATTGAACACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_138418.2-724s21c1
Sequence:CCGGCACCTGAAGTGCCAGCATTTGCTCGAGCAAATGCTGGCACTTCAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_138418.2-551s21c1
Sequence:CCGGGCAGAACTTTGTGCCCATTGACTCGAGTCAATGGGCACAAAGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_138418.2-331s21c1
Sequence:CCGGGGCCAAGGCTTGTGTTCAATCCTCGAGGATTGAACACAAGCCTTGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_138418.2-424s21c1
Sequence:CCGGACGAGGAGAATGTCCGCTTTGCTCGAGCAAAGCGGACATTCTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_138418.2-591s21c1
Sequence:CCGGCAGCAGTTCCTGGCGAGAATCCTCGAGGATTCTCGCCAGGAACTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026633
VALIDATED
FAM195A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 195, member A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026633.1-482s1c1
Sequence:CCGGGTACCTATTGACCTCGATGAGCTCGAGCTCATCGAGGTCAATAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026633.1-470s1c1
Sequence:CCGGCTACAGAACTTTGTACCTATTCTCGAGAATAGGTACAAAGTTCTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026633.1-486s1c1
Sequence:CCGGCTATTGACCTCGATGAGTGGTCTCGAGACCACTCATCGAGGTCAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026633.1-469s1c1
Sequence:CCGGGCTACAGAACTTTGTACCTATCTCGAGATAGGTACAAAGTTCTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026633.3-468s21c1
Sequence:CCGGCTACAGAACTTTGTACCTATTCTCGAGAATAGGTACAAAGTTCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026633.3-480s21c1
Sequence:CCGGGTACCTATTGACCTCGATGAGCTCGAGCTCATCGAGGTCAATAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026633.3-342s21c1
Sequence:CCGGCACGAGGAGAACGTCCGATTTCTCGAGAAATCGGACGTTCTCCTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026633.3-257s21c1
Sequence:CCGGACTTGTATTCAATCGAGTAAACTCGAGTTTACTCGATTGAATACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026633.3-641s21c1
Sequence:CCGGACACCTGAAGTGCCAACATTTCTCGAGAAATGTTGGCACTTCAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026633
VALIDATED
FAM195A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 195, member A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026633.1-482s1c1
Sequence:CCGGGTACCTATTGACCTCGATGAGCTCGAGCTCATCGAGGTCAATAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026633.1-470s1c1
Sequence:CCGGCTACAGAACTTTGTACCTATTCTCGAGAATAGGTACAAAGTTCTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026633.1-486s1c1
Sequence:CCGGCTATTGACCTCGATGAGTGGTCTCGAGACCACTCATCGAGGTCAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026633.1-469s1c1
Sequence:CCGGGCTACAGAACTTTGTACCTATCTCGAGATAGGTACAAAGTTCTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026633.3-468s21c1
Sequence:CCGGCTACAGAACTTTGTACCTATTCTCGAGAATAGGTACAAAGTTCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026633.3-480s21c1
Sequence:CCGGGTACCTATTGACCTCGATGAGCTCGAGCTCATCGAGGTCAATAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026633.3-342s21c1
Sequence:CCGGCACGAGGAGAACGTCCGATTTCTCGAGAAATCGGACGTTCTCCTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026633.3-257s21c1
Sequence:CCGGACTTGTATTCAATCGAGTAAACTCGAGTTTACTCGATTGAATACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026633.3-641s21c1
Sequence:CCGGACACCTGAAGTGCCAACATTTCTCGAGAAATGTTGGCACTTCAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026633
VALIDATED
FAM195A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 195, member A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026633.1-482s1c1
Sequence:CCGGGTACCTATTGACCTCGATGAGCTCGAGCTCATCGAGGTCAATAGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026633.1-470s1c1
Sequence:CCGGCTACAGAACTTTGTACCTATTCTCGAGAATAGGTACAAAGTTCTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026633.1-486s1c1
Sequence:CCGGCTATTGACCTCGATGAGTGGTCTCGAGACCACTCATCGAGGTCAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026633.1-469s1c1
Sequence:CCGGGCTACAGAACTTTGTACCTATCTCGAGATAGGTACAAAGTTCTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026633.3-468s21c1
Sequence:CCGGCTACAGAACTTTGTACCTATTCTCGAGAATAGGTACAAAGTTCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026633.3-480s21c1
Sequence:CCGGGTACCTATTGACCTCGATGAGCTCGAGCTCATCGAGGTCAATAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026633.3-342s21c1
Sequence:CCGGCACGAGGAGAACGTCCGATTTCTCGAGAAATCGGACGTTCTCCTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026633.3-257s21c1
Sequence:CCGGACTTGTATTCAATCGAGTAAACTCGAGTTTACTCGATTGAATACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026633.3-641s21c1
Sequence:CCGGACACCTGAAGTGCCAACATTTCTCGAGAAATGTTGGCACTTCAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)