EMAIL THIS PAGE TO A FRIEND

FAM195B

family with sequence similarity 195, member B

66 Gene Product Result for
UniProtKB ID: C9JLW8, Q6ZUL0
Gene ID:
Mouse(192173) family with sequence similarity 195, member B
Rat(360677) family with sequence similarity 195, member B
sheep(101115720) family with sequence similarity 195, member B
domestic guinea pig(100733386) family with sequence similarity 195, member B
naked mole-rat(101711245) family with sequence similarity 195, member B
Zebrafish(751762) family with sequence similarity 195, member B
chicken(101749776) family with sequence similarity 195, member B
chicken(101667071) family with sequence similarity 195, member B
dog(608012) family with sequence similarity 195, member B
domestic cat(101089224) family with sequence similarity 195, member B
cow(512391) family with sequence similarity 195, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033231 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033231 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033231 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207368 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001093767 Rosetta Predictions human pricing
NM_207368 Rosetta Predictions human pricing
NM_001108311 Rosetta Predictions rat pricing
NM_001033231 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318181 predicted 659
2 SASI_Hs02_00318182 predicted 204
3 SASI_Hs02_00318183 predicted 664
4 SASI_Hs02_00318184 predicted 207
5 SASI_Hs02_00318185 predicted 202
6 SASI_Hs02_00318186 predicted 196
7 SASI_Hs02_00318187 predicted 199
8 SASI_Hs02_00318188 predicted 658
9 SASI_Hs02_00318189 predicted 206
10 SASI_Hs02_00318190 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373959 predicted 200
2 SASI_Hs02_00373960 predicted 202
3 SASI_Hs02_00373961 predicted 206
4 SASI_Hs02_00373962 predicted 199
5 SASI_Hs02_00373963 predicted 197
6 SASI_Hs02_00373964 predicted 211
7 SASI_Hs02_00373965 predicted 339
8 SASI_Hs02_00373966 predicted 121
9 SASI_Hs02_00373967 predicted 330
10 SASI_Hs02_00373968 predicted 927
11 SASI_Hs01_00025447 predicted 1038
12 SASI_Hs01_00025448 predicted 1061
13 SASI_Hs01_00025449 predicted 1066
14 SASI_Hs01_00025450 predicted 1010
15 SASI_Hs01_00025451 predicted 794
16 SASI_Hs01_00025452 predicted 704
17 SASI_Hs01_00025453 predicted 720
18 SASI_Hs01_00025454 predicted 1026
19 SASI_Hs01_00025455 predicted 875
20 SASI_Hs01_00025456 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237409 predicted 223
2 SASI_Rn02_00237410 predicted 647
3 SASI_Rn02_00237411 predicted 550
4 SASI_Rn02_00237412 predicted 687
5 SASI_Rn02_00237413 predicted 379
6 SASI_Rn02_00237414 predicted 309
7 SASI_Rn02_00237415 predicted 545
8 SASI_Rn02_00237416 predicted 383
9 SASI_Rn02_00237417 predicted 533
10 SASI_Rn02_00237418 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115178 predicted 749
2 SASI_Mm01_00115179 predicted 286
3 SASI_Mm01_00115180 predicted 766
4 SASI_Mm01_00115181 predicted 374
5 SASI_Mm01_00115183 predicted 277
6 SASI_Mm01_00115184 predicted 346
7 SASI_Mm02_00288358 predicted 719
8 SASI_Mm01_00115186 predicted 337
9 SASI_Mm01_00115187 predicted 449
10 SASI_Mm02_00288359 predicted 358
11 SASI_Mm01_00115182 predicted 696
12 SASI_Mm01_00115185 predicted 655
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033231
VALIDATED
FAM195B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 195, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033231.2-217s21c1
Sequence:CCGGAGAGAATGTGCGCTTCATTTACTCGAGTAAATGAAGCGCACATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033231.2-767s21c1
Sequence:CCGGCGGCTGTTGGAACCTTGAAATCTCGAGATTTCAAGGTTCCAACAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033231.2-390s21c1
Sequence:CCGGAGGATGCCAAGAAGTCCTAGACTCGAGTCTAGGACTTCTTGGCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033231.2-296s21c1
Sequence:CCGGTGCCTAGTGGAGGAGTATGTGCTCGAGCACATACTCCTCCACTAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033231.2-180s21c1
Sequence:CCGGCCACCAACAGCAGTGAGATTTCTCGAGAAATCTCACTGCTGTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033231
VALIDATED
FAM195B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 195, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033231.2-217s21c1
Sequence:CCGGAGAGAATGTGCGCTTCATTTACTCGAGTAAATGAAGCGCACATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033231.2-767s21c1
Sequence:CCGGCGGCTGTTGGAACCTTGAAATCTCGAGATTTCAAGGTTCCAACAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033231.2-390s21c1
Sequence:CCGGAGGATGCCAAGAAGTCCTAGACTCGAGTCTAGGACTTCTTGGCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033231.2-296s21c1
Sequence:CCGGTGCCTAGTGGAGGAGTATGTGCTCGAGCACATACTCCTCCACTAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033231.2-180s21c1
Sequence:CCGGCCACCAACAGCAGTGAGATTTCTCGAGAAATCTCACTGCTGTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033231
VALIDATED
FAM195B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 195, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033231.2-217s21c1
Sequence:CCGGAGAGAATGTGCGCTTCATTTACTCGAGTAAATGAAGCGCACATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033231.2-767s21c1
Sequence:CCGGCGGCTGTTGGAACCTTGAAATCTCGAGATTTCAAGGTTCCAACAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033231.2-390s21c1
Sequence:CCGGAGGATGCCAAGAAGTCCTAGACTCGAGTCTAGGACTTCTTGGCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033231.2-296s21c1
Sequence:CCGGTGCCTAGTGGAGGAGTATGTGCTCGAGCACATACTCCTCCACTAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033231.2-180s21c1
Sequence:CCGGCCACCAACAGCAGTGAGATTTCTCGAGAAATCTCACTGCTGTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207368
VALIDATED
FAM195B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 195, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166762    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207368.1-866s1c1
Sequence:CCGGCCAAGAAAGGAGAGGTGACTTCTCGAGAAGTCACCTCTCCTTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160924    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207368.1-1026s1c1
Sequence:CCGGGATTCTTATCACGTGGTGTTTCTCGAGAAACACCACGTGATAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207368.1-882s1c1
Sequence:CCGGGACTTTGTGAGCAAACTGGGTCTCGAGACCCAGTTTGCTCACAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207368.1-1591s1c1
Sequence:CCGGGATCACCTTTAGGAAGCTCATCTCGAGATGAGCTTCCTAAAGGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207368.1-867s1c1
Sequence:CCGGCAAGAAAGGAGAGGTGACTTTCTCGAGAAAGTCACCTCTCCTTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164788    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207368.1-728s1c1
Sequence:CCGGCTTTCTCTGTAACGGGAGCTTCTCGAGAAGCTCCCGTTACAGAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207368.1-875s1c1
Sequence:CCGGGAGAGGTGACTTTGTGAGCAACTCGAGTTGCTCACAAAGTCACCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207368.1-1014s1c1
Sequence:CCGGCTTGAGCCGTGGGATTCTTATCTCGAGATAAGAATCCCACGGCTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207368
VALIDATED
FAM195B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 195, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166762    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207368.1-866s1c1
Sequence:CCGGCCAAGAAAGGAGAGGTGACTTCTCGAGAAGTCACCTCTCCTTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160924    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207368.1-1026s1c1
Sequence:CCGGGATTCTTATCACGTGGTGTTTCTCGAGAAACACCACGTGATAAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207368.1-882s1c1
Sequence:CCGGGACTTTGTGAGCAAACTGGGTCTCGAGACCCAGTTTGCTCACAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207368.1-1591s1c1
Sequence:CCGGGATCACCTTTAGGAAGCTCATCTCGAGATGAGCTTCCTAAAGGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207368.1-867s1c1
Sequence:CCGGCAAGAAAGGAGAGGTGACTTTCTCGAGAAAGTCACCTCTCCTTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164788    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207368.1-728s1c1
Sequence:CCGGCTTTCTCTGTAACGGGAGCTTCTCGAGAAGCTCCCGTTACAGAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207368.1-875s1c1
Sequence:CCGGGAGAGGTGACTTTGTGAGCAACTCGAGTTGCTCACAAAGTCACCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207368.1-1014s1c1
Sequence:CCGGCTTGAGCCGTGGGATTCTTATCTCGAGATAAGAATCCCACGGCTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207368
VALIDATED
FAM195B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 195, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166762    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207368.1-866s1c1
Sequence:CCGGCCAAGAAAGGAGAGGTGACTTCTCGAGAAGTCACCTCTCCTTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160924    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207368.1-1026s1c1
Sequence:CCGGGATTCTTATCACGTGGTGTTTCTCGAGAAACACCACGTGATAAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207368.1-882s1c1
Sequence:CCGGGACTTTGTGAGCAAACTGGGTCTCGAGACCCAGTTTGCTCACAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207368.1-1591s1c1
Sequence:CCGGGATCACCTTTAGGAAGCTCATCTCGAGATGAGCTTCCTAAAGGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207368.1-867s1c1
Sequence:CCGGCAAGAAAGGAGAGGTGACTTTCTCGAGAAAGTCACCTCTCCTTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164788    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207368.1-728s1c1
Sequence:CCGGCTTTCTCTGTAACGGGAGCTTCTCGAGAAGCTCCCGTTACAGAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207368.1-875s1c1
Sequence:CCGGGAGAGGTGACTTTGTGAGCAACTCGAGTTGCTCACAAAGTCACCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207368.1-1014s1c1
Sequence:CCGGCTTGAGCCGTGGGATTCTTATCTCGAGATAAGAATCCCACGGCTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)