EMAIL THIS PAGE TO A FRIEND

FAM196A

family with sequence similarity 196, member A

137 Gene Product Result for
Synonyms: C10orf141
UniProtKB ID: Q6ZSG2, B2RNT4
Gene ID:
Mouse(627214) family with sequence similarity 196, member A
Rat(100233213) family with sequence similarity 196, member A
chicken(101669660) family with sequence similarity 196, member A
chicken(101748342) family with sequence similarity 196, member A
cow(784700) family with sequence similarity 196, member A
domestic cat(101081834) family with sequence similarity 196, member A
dog(100685103) family with sequence similarity 196, member A
naked mole-rat(101717805) family with sequence similarity 196, member A
domestic guinea pig(100732256) family with sequence similarity 196, member A
sheep(101116947) family with sequence similarity 196, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001143802 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001143802 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001143802 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039762 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU186311 MISSION® esiRNA esiRNA targeting mouse Fam196a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039762 Rosetta Predictions human pricing
XM_001480332 Rosetta Predictions mouse pricing
XM_894743 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045848 predicted 1971
2 SASI_Hs01_00045849 predicted 2034
3 SASI_Hs01_00045850 predicted 1591
4 SASI_Hs01_00045851 predicted 1887
5 SASI_Hs01_00045852 predicted 879
6 SASI_Hs01_00045853 predicted 555
7 SASI_Hs01_00045854 predicted 1692
8 SASI_Hs01_00045855 predicted 1793
9 SASI_Hs01_00045856 predicted 695
10 SASI_Hs01_00045857 predicted 1834
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480332 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00416758 predicted 355
2 SASI_Mm02_00416759 predicted 341
3 SASI_Mm02_00416760 predicted 1383
4 SASI_Mm02_00416761 predicted 244
5 SASI_Mm02_00416762 predicted 585
6 SASI_Mm02_00416763 predicted 280
7 SASI_Mm02_00416764 predicted 360
8 SASI_Mm02_00416765 predicted 696
9 SASI_Mm02_00416766 predicted 1054
10 SASI_Mm02_00416767 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264448 predicted 363
2 SASI_Mm02_00429552 predicted 323
3 SASI_Mm01_00264449 predicted 344
4 SASI_Mm01_00264450 predicted 246
5 SASI_Mm01_00264453 predicted 585
6 SASI_Mm01_00264455 predicted 696
7 SASI_Mm02_00429553 predicted 415
8 SASI_Mm02_00429554 predicted 273
9 SASI_Mm02_00429555 predicted 411
10 SASI_Mm02_00429556 predicted 244
11 SASI_Mm01_00264451 predicted 816
12 SASI_Mm01_00264452 predicted 1754
13 SASI_Mm01_00264454 predicted 1089
14 SASI_Mm01_00264456 predicted 1789
15 SASI_Mm01_00264457 predicted 1147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143802
FAM196A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 196, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143802.1-1871s21c1
Sequence:CCGGCATCGGGAAGGGCTTTCATATCTCGAGATATGAAAGCCCTTCCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143802.1-2484s21c1
Sequence:CCGGACAGTAGAACTTCTCATTATTCTCGAGAATAATGAGAAGTTCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143802.1-1782s21c1
Sequence:CCGGTGCAGGTGATGGAGAACTTAACTCGAGTTAAGTTCTCCATCACCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143802.1-966s21c1
Sequence:CCGGGGGTGGCCTATCGTAAGTATACTCGAGTATACTTACGATAGGCCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143802.1-1451s21c1
Sequence:CCGGACCCACGGAAGGGTGTTTAAACTCGAGTTTAAACACCCTTCCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143802
FAM196A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 196, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143802.1-1871s21c1
Sequence:CCGGCATCGGGAAGGGCTTTCATATCTCGAGATATGAAAGCCCTTCCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143802.1-2484s21c1
Sequence:CCGGACAGTAGAACTTCTCATTATTCTCGAGAATAATGAGAAGTTCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143802.1-1782s21c1
Sequence:CCGGTGCAGGTGATGGAGAACTTAACTCGAGTTAAGTTCTCCATCACCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143802.1-966s21c1
Sequence:CCGGGGGTGGCCTATCGTAAGTATACTCGAGTATACTTACGATAGGCCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143802.1-1451s21c1
Sequence:CCGGACCCACGGAAGGGTGTTTAAACTCGAGTTTAAACACCCTTCCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143802
FAM196A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 196, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143802.1-1871s21c1
Sequence:CCGGCATCGGGAAGGGCTTTCATATCTCGAGATATGAAAGCCCTTCCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143802.1-2484s21c1
Sequence:CCGGACAGTAGAACTTCTCATTATTCTCGAGAATAATGAGAAGTTCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143802.1-1782s21c1
Sequence:CCGGTGCAGGTGATGGAGAACTTAACTCGAGTTAAGTTCTCCATCACCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143802.1-966s21c1
Sequence:CCGGGGGTGGCCTATCGTAAGTATACTCGAGTATACTTACGATAGGCCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143802.1-1451s21c1
Sequence:CCGGACCCACGGAAGGGTGTTTAAACTCGAGTTTAAACACCCTTCCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039762
FAM196A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 196, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039762.2-3062s21c1
Sequence:CCGGTCGCCTACATTTAACCTATTACTCGAGTAATAGGTTAAATGTAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039762.2-796s21c1
Sequence:CCGGCAGAGCAGCCTACCGCAAATACTCGAGTATTTGCGGTAGGCTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039762.2-1843s21c1
Sequence:CCGGCAAACTCCAGCCGGTTCTAAGCTCGAGCTTAGAACCGGCTGGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039762.2-1201s21c1
Sequence:CCGGTCCATCCGAAGAGCCCGATTACTCGAGTAATCGGGCTCTTCGGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039762.2-1730s21c1
Sequence:CCGGCATCGGGAAGGGCTTTCATATCTCGAGATATGAAAGCCCTTCCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039762
FAM196A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 196, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039762.2-3062s21c1
Sequence:CCGGTCGCCTACATTTAACCTATTACTCGAGTAATAGGTTAAATGTAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039762.2-796s21c1
Sequence:CCGGCAGAGCAGCCTACCGCAAATACTCGAGTATTTGCGGTAGGCTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039762.2-1843s21c1
Sequence:CCGGCAAACTCCAGCCGGTTCTAAGCTCGAGCTTAGAACCGGCTGGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039762.2-1201s21c1
Sequence:CCGGTCCATCCGAAGAGCCCGATTACTCGAGTAATCGGGCTCTTCGGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039762.2-1730s21c1
Sequence:CCGGCATCGGGAAGGGCTTTCATATCTCGAGATATGAAAGCCCTTCCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039762
FAM196A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 196, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039762.2-3062s21c1
Sequence:CCGGTCGCCTACATTTAACCTATTACTCGAGTAATAGGTTAAATGTAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039762.2-796s21c1
Sequence:CCGGCAGAGCAGCCTACCGCAAATACTCGAGTATTTGCGGTAGGCTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039762.2-1843s21c1
Sequence:CCGGCAAACTCCAGCCGGTTCTAAGCTCGAGCTTAGAACCGGCTGGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039762.2-1201s21c1
Sequence:CCGGTCCATCCGAAGAGCCCGATTACTCGAGTAATCGGGCTCTTCGGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039762.2-1730s21c1
Sequence:CCGGCATCGGGAAGGGCTTTCATATCTCGAGATATGAAAGCCCTTCCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks