EMAIL THIS PAGE TO A FRIEND

FAM196B

family with sequence similarity 196, member B

Synonyms: C5orf57
UniProtKB ID: A6NMK8
Gene ID:
Mouse(574403) family with sequence similarity 196, member B
Rat(100361460) family with sequence similarity 196, member B
chicken(101749501) family with sequence similarity 196, member B
chicken(101665711) family with sequence similarity 196, member B
cow(100335985) family with sequence similarity 196, member B
domestic cat(101097789) family with sequence similarity 196, member B
dog(100683560) family with sequence similarity 196, member B
sheep(101105025) family with sequence similarity 196, member B
naked mole-rat(101707266) family with sequence similarity 196, member B
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001129891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001129891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001129891 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025382 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025382 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025382 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001719710 Rosetta Predictions human pricing
XM_001722329 Rosetta Predictions human pricing
XM_001725433 Rosetta Predictions human pricing
NM_001025382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00432114 predicted 2562
2 SASI_Hs02_00432115 predicted 1407
3 SASI_Hs02_00432116 predicted 2719
4 SASI_Hs02_00432117 predicted 2774
5 SASI_Hs02_00432118 predicted 1510
6 SASI_Hs02_00432119 predicted 1433
7 SASI_Hs02_00432120 predicted 3056
8 SASI_Hs02_00432121 predicted 2273
9 SASI_Hs02_00432122 predicted 1947
10 SASI_Hs02_00432123 predicted 2068
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00448459 predicted 2558
2 SASI_Hs02_00448460 predicted 2714
3 SASI_Hs02_00448461 predicted 2775
4 SASI_Hs02_00448462 predicted 1515
5 SASI_Hs02_00448463 predicted 1432
6 SASI_Hs02_00448464 predicted 3049
7 SASI_Hs02_00448465 predicted 2272
8 SASI_Hs02_00448466 predicted 2696
9 SASI_Hs02_00448467 predicted 1949
10 SASI_Hs02_00448468 predicted 2070
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00467703 predicted 2563
2 SASI_Hs02_00467704 predicted 2719
3 SASI_Hs02_00467705 predicted 2773
4 SASI_Hs02_00467706 predicted 1519
5 SASI_Hs02_00467707 predicted 1430
6 SASI_Hs02_00467708 predicted 3052
7 SASI_Hs02_00467709 predicted 2278
8 SASI_Hs02_00467710 predicted 2695
9 SASI_Hs02_00467711 predicted 1950
10 SASI_Hs02_00467712 predicted 2072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114094 predicted 1032
2 SASI_Mm01_00114096 predicted 1196
3 SASI_Mm01_00114097 predicted 1468
4 SASI_Mm01_00114098 predicted 1870
5 SASI_Mm01_00114099 predicted 1647
6 SASI_Mm01_00114100 predicted 1482
7 SASI_Mm01_00114101 predicted 1363
8 SASI_Mm02_00287857 predicted 1994
9 SASI_Mm01_00114102 predicted 1708
10 SASI_Mm01_00114103 predicted 698
11 SASI_Mm01_00114095 predicted 2082
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001129891
FAM196B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 196, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129891.1-3344s21c1
Sequence:CCGGTTCCCATCCTGGGTTCATAAACTCGAGTTTATGAACCCAGGATGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129891.1-1816s21c1
Sequence:CCGGCTTCTGACCTTGCCTACTTAACTCGAGTTAAGTAGGCAAGGTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129891.1-1987s21c1
Sequence:CCGGTTCAGGTTCCAGATGATATTTCTCGAGAAATATCATCTGGAACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129891.1-2780s21c1
Sequence:CCGGGAACACGGCGTGCATCATATACTCGAGTATATGATGCACGCCGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129891.1-2055s21c1
Sequence:CCGGAGGTCAGCTGAAGTAAGTAACCTCGAGGTTACTTACTTCAGCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001129891
FAM196B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 196, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129891.1-3344s21c1
Sequence:CCGGTTCCCATCCTGGGTTCATAAACTCGAGTTTATGAACCCAGGATGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129891.1-1816s21c1
Sequence:CCGGCTTCTGACCTTGCCTACTTAACTCGAGTTAAGTAGGCAAGGTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129891.1-1987s21c1
Sequence:CCGGTTCAGGTTCCAGATGATATTTCTCGAGAAATATCATCTGGAACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129891.1-2780s21c1
Sequence:CCGGGAACACGGCGTGCATCATATACTCGAGTATATGATGCACGCCGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129891.1-2055s21c1
Sequence:CCGGAGGTCAGCTGAAGTAAGTAACCTCGAGGTTACTTACTTCAGCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001129891
FAM196B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 196, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129891.1-3344s21c1
Sequence:CCGGTTCCCATCCTGGGTTCATAAACTCGAGTTTATGAACCCAGGATGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129891.1-1816s21c1
Sequence:CCGGCTTCTGACCTTGCCTACTTAACTCGAGTTAAGTAGGCAAGGTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129891.1-1987s21c1
Sequence:CCGGTTCAGGTTCCAGATGATATTTCTCGAGAAATATCATCTGGAACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129891.1-2780s21c1
Sequence:CCGGGAACACGGCGTGCATCATATACTCGAGTATATGATGCACGCCGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129891.1-2055s21c1
Sequence:CCGGAGGTCAGCTGAAGTAAGTAACCTCGAGGTTACTTACTTCAGCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025382
FAM196B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 196, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000270702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025382.1-1472s21c1
Sequence:CCGGCAATAGCAGTGCCAGTAATATCTCGAGATATTACTGGCACTGCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025382.1-805s21c1
Sequence:CCGGTCAAGGAAGATGGCAACATTACTCGAGTAATGTTGCCATCTTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025382.1-2086s21c1
Sequence:CCGGAGAACACAGCATGCATCATATCTCGAGATATGATGCATGCTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025382.1-1368s21c1
Sequence:CCGGGCTGAAGAGAGCAACTCTATACTCGAGTATAGAGTTGCTCTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025382.1-2904s21c1
Sequence:CCGGTAAGGTTGCCCATGGGTATTACTCGAGTAATACCCATGGGCAACCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025382
FAM196B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 196, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000270702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025382.1-1472s21c1
Sequence:CCGGCAATAGCAGTGCCAGTAATATCTCGAGATATTACTGGCACTGCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025382.1-805s21c1
Sequence:CCGGTCAAGGAAGATGGCAACATTACTCGAGTAATGTTGCCATCTTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025382.1-2086s21c1
Sequence:CCGGAGAACACAGCATGCATCATATCTCGAGATATGATGCATGCTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025382.1-1368s21c1
Sequence:CCGGGCTGAAGAGAGCAACTCTATACTCGAGTATAGAGTTGCTCTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025382.1-2904s21c1
Sequence:CCGGTAAGGTTGCCCATGGGTATTACTCGAGTAATACCCATGGGCAACCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025382
FAM196B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 196, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000270702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025382.1-1472s21c1
Sequence:CCGGCAATAGCAGTGCCAGTAATATCTCGAGATATTACTGGCACTGCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025382.1-805s21c1
Sequence:CCGGTCAAGGAAGATGGCAACATTACTCGAGTAATGTTGCCATCTTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025382.1-2086s21c1
Sequence:CCGGAGAACACAGCATGCATCATATCTCGAGATATGATGCATGCTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025382.1-1368s21c1
Sequence:CCGGGCTGAAGAGAGCAACTCTATACTCGAGTATAGAGTTGCTCTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025382.1-2904s21c1
Sequence:CCGGTAAGGTTGCCCATGGGTATTACTCGAGTAATACCCATGGGCAACCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks