EMAIL THIS PAGE TO A FRIEND

FAM198A

family with sequence similarity 198, member A

73 Gene Product Result for
Synonyms: C3orf41
UniProtKB ID: Q9UFP1, B3KR48
Gene ID:
Mouse(245050) family with sequence similarity 198, member A
Rat(316090) family with sequence similarity 198, member A
chicken(100857278) family with sequence similarity 198, member A
cow(615162) family with sequence similarity 198, member A
dog(609686) family with sequence similarity 198, member A
domestic cat(101081752) family with sequence similarity 198, member A
naked mole-rat(101711069) family with sequence similarity 198, member A
domestic guinea pig(100713867) family with sequence similarity 198, member A
sheep(101120361) family with sequence similarity 198, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047726 Anti-FAM198A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001129908 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001129908 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001129908 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177743 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177743 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177743 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001133294 Rosetta Predictions human pricing
XM_001724952 Rosetta Predictions human pricing
XM_001725043 Rosetta Predictions human pricing
XM_001078210 Rosetta Predictions rat pricing
XM_236724 Rosetta Predictions rat pricing
NM_177743 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001133294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00390591 predicted 2115
2 SASI_Hs02_00390592 predicted 1802
3 SASI_Hs02_00390593 predicted 1881
4 SASI_Hs02_00390594 predicted 661
5 SASI_Hs02_00390595 predicted 1080
6 SASI_Hs02_00390596 predicted 652
7 SASI_Hs02_00390597 predicted 614
8 SASI_Hs02_00390598 predicted 1475
9 SASI_Hs02_00390599 predicted 1105
10 SASI_Hs02_00390600 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00464566 predicted 544
2 SASI_Hs02_00464567 predicted 1875
3 SASI_Hs02_00464568 predicted 1800
4 SASI_Hs02_00464569 predicted 1085
5 SASI_Hs02_00464570 predicted 1106
6 SASI_Hs02_00464571 predicted 926
7 SASI_Hs02_00464572 predicted 443
8 SASI_Hs02_00464573 predicted 2298
9 SASI_Hs02_00464574 predicted 1005
10 SASI_Hs02_00464575 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00465219 predicted 377
2 SASI_Hs02_00465220 predicted 2111
3 SASI_Hs02_00465221 predicted 1801
4 SASI_Hs02_00465222 predicted 1876
5 SASI_Hs02_00465223 predicted 657
6 SASI_Hs02_00465224 predicted 1083
7 SASI_Hs02_00465225 predicted 646
8 SASI_Hs02_00465226 predicted 611
9 SASI_Hs02_00465227 predicted 1110
10 SASI_Hs02_00465228 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359971 predicted 1407
2 SASI_Rn02_00359972 predicted 1623
3 SASI_Rn02_00359973 predicted 1583
4 SASI_Rn02_00359974 predicted 1657
5 SASI_Rn02_00359975 predicted 1914
6 SASI_Rn02_00359976 predicted 1011
7 SASI_Rn02_00359977 predicted 467
8 SASI_Rn02_00359978 predicted 1774
9 SASI_Rn02_00359979 predicted 432
10 SASI_Rn02_00359980 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00134541 predicted 1407
2 SASI_Rn01_00134542 predicted 1621
3 SASI_Rn01_00134543 predicted 1581
4 SASI_Rn01_00134544 predicted 1655
5 SASI_Rn01_00134546 predicted 1579
6 SASI_Rn01_00134547 predicted 1580
7 SASI_Rn01_00134548 predicted 1778
8 SASI_Rn01_00134549 predicted 1249
9 SASI_Rn01_00134550 predicted 1408
10 SASI_Rn02_00390379 predicted 1267
11 SASI_Rn01_00134545 predicted 1673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185752 predicted 1357
2 SASI_Mm01_00185753 predicted 905
3 SASI_Mm02_00348115 predicted 1724
4 SASI_Mm01_00185754 predicted 1528
5 SASI_Mm01_00185755 predicted 1769
6 SASI_Mm01_00185757 predicted 887
7 SASI_Mm01_00185758 predicted 600
8 SASI_Mm01_00185759 predicted 1024
9 SASI_Mm01_00185760 predicted 1203
10 SASI_Mm02_00348116 predicted 692
11 SASI_Mm01_00185756 predicted 1462
12 SASI_Mm01_00185761 predicted 593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001129908
FAM198A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 198, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129908.2-728s21c1
Sequence:CCGGGTGAGGAGGGACATTACTTTGCTCGAGCAAAGTAATGTCCCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129908.2-1811s21c1
Sequence:CCGGCACCTGGTCTACATCGATAACCTCGAGGTTATCGATGTAGACCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129908.2-2084s21c1
Sequence:CCGGTTCAGGGACGAGGACCCATAACTCGAGTTATGGGTCCTCGTCCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129908.2-1918s21c1
Sequence:CCGGTCTCGCATCAGGGTGTCTACACTCGAGTGTAGACACCCTGATGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129908.2-2209s21c1
Sequence:CCGGCAAGGATGTCACGGGATATTTCTCGAGAAATATCCCGTGACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001129908
FAM198A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 198, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129908.2-728s21c1
Sequence:CCGGGTGAGGAGGGACATTACTTTGCTCGAGCAAAGTAATGTCCCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129908.2-1811s21c1
Sequence:CCGGCACCTGGTCTACATCGATAACCTCGAGGTTATCGATGTAGACCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129908.2-2084s21c1
Sequence:CCGGTTCAGGGACGAGGACCCATAACTCGAGTTATGGGTCCTCGTCCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129908.2-1918s21c1
Sequence:CCGGTCTCGCATCAGGGTGTCTACACTCGAGTGTAGACACCCTGATGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129908.2-2209s21c1
Sequence:CCGGCAAGGATGTCACGGGATATTTCTCGAGAAATATCCCGTGACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001129908
FAM198A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 198, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129908.2-728s21c1
Sequence:CCGGGTGAGGAGGGACATTACTTTGCTCGAGCAAAGTAATGTCCCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129908.2-1811s21c1
Sequence:CCGGCACCTGGTCTACATCGATAACCTCGAGGTTATCGATGTAGACCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129908.2-2084s21c1
Sequence:CCGGTTCAGGGACGAGGACCCATAACTCGAGTTATGGGTCCTCGTCCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129908.2-1918s21c1
Sequence:CCGGTCTCGCATCAGGGTGTCTACACTCGAGTGTAGACACCCTGATGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129908.2-2209s21c1
Sequence:CCGGCAAGGATGTCACGGGATATTTCTCGAGAAATATCCCGTGACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177743
FAM198A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 198, member A
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177743.3-888s1c1
Sequence:CCGGCATGGAACATGATGCACAAACCTCGAGGTTTGTGCATCATGTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177743.2-1783s1c1
Sequence:CCGGGAGACACATTAAGAAGCACAACTCGAGTTGTGCTTCTTAATGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177743.2-1917s1c1
Sequence:CCGGGACAGCATTTCTGTGACAGTACTCGAGTACTGTCACAGAAATGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177743.2-500s1c1
Sequence:CCGGCAGGATCGTGAGCTTCTATTACTCGAGTAATAGAAGCTCACGATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177743.2-328s1c1
Sequence:CCGGGCAGACTTTGAACTCTAGCCTCTCGAGAGGCTAGAGTTCAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177743.2-627s1c1
Sequence:CCGGCAGAGAGAAGCCACGAATCTTCTCGAGAAGATTCGTGGCTTCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177743
FAM198A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 198, member A
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177743.3-888s1c1
Sequence:CCGGCATGGAACATGATGCACAAACCTCGAGGTTTGTGCATCATGTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177743.2-1783s1c1
Sequence:CCGGGAGACACATTAAGAAGCACAACTCGAGTTGTGCTTCTTAATGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177743.2-1917s1c1
Sequence:CCGGGACAGCATTTCTGTGACAGTACTCGAGTACTGTCACAGAAATGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177743.2-500s1c1
Sequence:CCGGCAGGATCGTGAGCTTCTATTACTCGAGTAATAGAAGCTCACGATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177743.2-328s1c1
Sequence:CCGGGCAGACTTTGAACTCTAGCCTCTCGAGAGGCTAGAGTTCAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177743.2-627s1c1
Sequence:CCGGCAGAGAGAAGCCACGAATCTTCTCGAGAAGATTCGTGGCTTCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177743
FAM198A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 198, member A
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177743.3-888s1c1
Sequence:CCGGCATGGAACATGATGCACAAACCTCGAGGTTTGTGCATCATGTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177743.2-1783s1c1
Sequence:CCGGGAGACACATTAAGAAGCACAACTCGAGTTGTGCTTCTTAATGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177743.2-1917s1c1
Sequence:CCGGGACAGCATTTCTGTGACAGTACTCGAGTACTGTCACAGAAATGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177743.2-500s1c1
Sequence:CCGGCAGGATCGTGAGCTTCTATTACTCGAGTAATAGAAGCTCACGATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177743.2-328s1c1
Sequence:CCGGGCAGACTTTGAACTCTAGCCTCTCGAGAGGCTAGAGTTCAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177743.2-627s1c1
Sequence:CCGGCAGAGAGAAGCCACGAATCTTCTCGAGAAGATTCGTGGCTTCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks