EMAIL THIS PAGE TO A FRIEND

FAM198B

family with sequence similarity 198, member B

95 Gene Product Result for
Synonyms: AD036 C4orf18
UniProtKB ID: Q6UWH4, Q498Z3, Q6IAF9, Q6ZMF2, Q86XL0
Gene ID:
Mouse(68659) family with sequence similarity 198, member B
Rat(310540) family with sequence similarity 198, member B
sheep(101112349) family with sequence similarity 198, member B
domestic guinea pig(100721458) family with sequence similarity 198, member B
naked mole-rat(101722421) family with sequence similarity 198, member B
Zebrafish(566369) family with sequence similarity 198, member B
chicken(422413) family with sequence similarity 198, member B
cow(617515) family with sequence similarity 198, member B
domestic cat(101087989) family with sequence similarity 198, member B
dog(100685456) family with sequence similarity 198, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016613 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133187 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133187 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133187 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031700 Rosetta Predictions human pricing
NM_001128424 Rosetta Predictions human pricing
NM_016613 Rosetta Predictions human pricing
NM_199105 Rosetta Predictions rat pricing
NM_133187 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054105 predicted 2379
2 SASI_Hs01_00054106 predicted 2187
3 SASI_Hs01_00054107 predicted 2335
4 SASI_Hs01_00054108 predicted 2236
5 SASI_Hs01_00054109 predicted 2449
6 SASI_Hs01_00054110 predicted 2118
7 SASI_Hs01_00054111 predicted 429
8 SASI_Hs01_00054112 predicted 2212
9 SASI_Hs01_00054113 predicted 2377
10 SASI_Hs01_00054114 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331126 predicted 2158
2 SASI_Hs02_00331127 predicted 2213
3 SASI_Hs02_00331128 predicted 1531
4 SASI_Hs02_00331129 predicted 1234
5 SASI_Hs02_00331130 predicted 2096
6 SASI_Hs02_00331131 predicted 2190
7 SASI_Hs02_00331132 predicted 903
8 SASI_Hs02_00331133 predicted 1574
9 SASI_Hs02_00331134 predicted 2211
10 SASI_Hs02_00331135 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079290 predicted 2219
2 SASI_Hs01_00079291 predicted 2029
3 SASI_Hs01_00079292 predicted 2179
4 SASI_Hs01_00079293 predicted 2085
5 SASI_Hs01_00079294 predicted 2299
6 SASI_Hs01_00079295 predicted 1964
7 SASI_Hs01_00079296 predicted 298
8 SASI_Hs01_00079297 predicted 2057
9 SASI_Hs01_00079298 predicted 2224
10 SASI_Hs01_00079299 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046466 predicted 1780
2 SASI_Rn01_00046467 predicted 1624
3 SASI_Rn01_00046468 predicted 1950
4 SASI_Rn01_00046469 predicted 1200
5 SASI_Rn01_00046471 predicted 1541
6 SASI_Rn02_00270125 predicted 1897
7 SASI_Rn01_00046472 predicted 1934
8 SASI_Rn01_00046473 predicted 1314
9 SASI_Rn01_00046474 predicted 1776
10 SASI_Rn01_00046475 predicted 1249
11 SASI_Rn01_00046470 predicted 1941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338352 predicted 1186
2 SASI_Mm02_00338353 predicted 295
3 SASI_Mm02_00338354 predicted 1840
4 SASI_Mm02_00338355 predicted 1430
5 SASI_Mm02_00338356 predicted 1474
6 SASI_Mm02_00338357 predicted 1733
7 SASI_Mm02_00338358 predicted 1148
8 SASI_Mm02_00338359 predicted 1897
9 SASI_Mm02_00338360 predicted 823
10 SASI_Mm02_00338361 predicted 1399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016613
VALIDATED
FAM198B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 198, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016613.4-1581s1c1
Sequence:CCGGGACAGGAGTGAAGATAACTTACTCGAGTAAGTTATCTTCACTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016613.4-3465s1c1
Sequence:CCGGGCTCACATTCATGTACTACTTCTCGAGAAGTAGTACATGAATGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016613.4-1761s1c1
Sequence:CCGGGTAATAGAACACAGAGCCAAACTCGAGTTTGGCTCTGTGTTCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016613.4-929s1c1
Sequence:CCGGCAAAGATGACATCCGAAGAATCTCGAGATTCTTCGGATGTCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016613.4-1372s1c1
Sequence:CCGGCCAAGATGGCACTCTTTGATTCTCGAGAATCAAAGAGTGCCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016613.4-1674s1c1
Sequence:CCGGCGGCAGAAACTTCTTCAGTCTCTCGAGAGACTGAAGAAGTTTCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016613.4-1163s1c1
Sequence:CCGGGAGCAGGAAAGCAGAGTTCATCTCGAGATGAACTCTGCTTTCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016613.4-1531s1c1
Sequence:CCGGGAAAGCATGACCCAAGGCATTCTCGAGAATGCCTTGGGTCATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016613.4-1701s1c1
Sequence:CCGGCTTGATAAAGTGTATTGGGAACTCGAGTTCCCAATACACTTTATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016613
VALIDATED
FAM198B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 198, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016613.4-1581s1c1
Sequence:CCGGGACAGGAGTGAAGATAACTTACTCGAGTAAGTTATCTTCACTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016613.4-3465s1c1
Sequence:CCGGGCTCACATTCATGTACTACTTCTCGAGAAGTAGTACATGAATGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016613.4-1761s1c1
Sequence:CCGGGTAATAGAACACAGAGCCAAACTCGAGTTTGGCTCTGTGTTCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016613.4-929s1c1
Sequence:CCGGCAAAGATGACATCCGAAGAATCTCGAGATTCTTCGGATGTCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016613.4-1372s1c1
Sequence:CCGGCCAAGATGGCACTCTTTGATTCTCGAGAATCAAAGAGTGCCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016613.4-1674s1c1
Sequence:CCGGCGGCAGAAACTTCTTCAGTCTCTCGAGAGACTGAAGAAGTTTCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016613.4-1163s1c1
Sequence:CCGGGAGCAGGAAAGCAGAGTTCATCTCGAGATGAACTCTGCTTTCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016613.4-1531s1c1
Sequence:CCGGGAAAGCATGACCCAAGGCATTCTCGAGAATGCCTTGGGTCATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016613.4-1701s1c1
Sequence:CCGGCTTGATAAAGTGTATTGGGAACTCGAGTTCCCAATACACTTTATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016613
VALIDATED
FAM198B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 198, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016613.4-1581s1c1
Sequence:CCGGGACAGGAGTGAAGATAACTTACTCGAGTAAGTTATCTTCACTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016613.4-3465s1c1
Sequence:CCGGGCTCACATTCATGTACTACTTCTCGAGAAGTAGTACATGAATGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016613.4-1761s1c1
Sequence:CCGGGTAATAGAACACAGAGCCAAACTCGAGTTTGGCTCTGTGTTCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016613.4-929s1c1
Sequence:CCGGCAAAGATGACATCCGAAGAATCTCGAGATTCTTCGGATGTCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016613.4-1372s1c1
Sequence:CCGGCCAAGATGGCACTCTTTGATTCTCGAGAATCAAAGAGTGCCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016613.4-1674s1c1
Sequence:CCGGCGGCAGAAACTTCTTCAGTCTCTCGAGAGACTGAAGAAGTTTCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016613.4-1163s1c1
Sequence:CCGGGAGCAGGAAAGCAGAGTTCATCTCGAGATGAACTCTGCTTTCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016613.4-1531s1c1
Sequence:CCGGGAAAGCATGACCCAAGGCATTCTCGAGAATGCCTTGGGTCATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016613.4-1701s1c1
Sequence:CCGGCTTGATAAAGTGTATTGGGAACTCGAGTTCCCAATACACTTTATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133187
VALIDATED
FAM198B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 198, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133187.3-1628s21c1
Sequence:CCGGTAGAAGGCATCCGAGAGTTTCCTCGAGGAAACTCTCGGATGCCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133187.3-656s21c1
Sequence:CCGGATATCCGTGGCACGGTGAAACCTCGAGGTTTCACCGTGCCACGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133187.3-1420s21c1
Sequence:CCGGTATAATCGCTTGGATACAAATCTCGAGATTTGTATCCAAGCGATTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133187.3-2404s21c1
Sequence:CCGGTCGTTACAAACGACCAGTATACTCGAGTATACTGGTCGTTTGTAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133187.3-731s21c1
Sequence:CCGGTGGTTAGACCATCCCTTATACCTCGAGGTATAAGGGATGGTCTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133187
VALIDATED
FAM198B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 198, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133187.3-1628s21c1
Sequence:CCGGTAGAAGGCATCCGAGAGTTTCCTCGAGGAAACTCTCGGATGCCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133187.3-656s21c1
Sequence:CCGGATATCCGTGGCACGGTGAAACCTCGAGGTTTCACCGTGCCACGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133187.3-1420s21c1
Sequence:CCGGTATAATCGCTTGGATACAAATCTCGAGATTTGTATCCAAGCGATTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133187.3-2404s21c1
Sequence:CCGGTCGTTACAAACGACCAGTATACTCGAGTATACTGGTCGTTTGTAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133187.3-731s21c1
Sequence:CCGGTGGTTAGACCATCCCTTATACCTCGAGGTATAAGGGATGGTCTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133187
VALIDATED
FAM198B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 198, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133187.3-1628s21c1
Sequence:CCGGTAGAAGGCATCCGAGAGTTTCCTCGAGGAAACTCTCGGATGCCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133187.3-656s21c1
Sequence:CCGGATATCCGTGGCACGGTGAAACCTCGAGGTTTCACCGTGCCACGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133187.3-1420s21c1
Sequence:CCGGTATAATCGCTTGGATACAAATCTCGAGATTTGTATCCAAGCGATTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133187.3-2404s21c1
Sequence:CCGGTCGTTACAAACGACCAGTATACTCGAGTATACTGGTCGTTTGTAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133187.3-731s21c1
Sequence:CCGGTGGTTAGACCATCCCTTATACCTCGAGGTATAAGGGATGGTCTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks