EMAIL THIS PAGE TO A FRIEND

FAM199X

family with sequence similarity 199, X-linked

141 Gene Product Result for
Synonyms: CXorf39
UniProtKB ID: Q6PEV8, Q8WVP6, Q96AV3
Gene ID:
Mouse(245622) family with sequence similarity 199, X-linked
Zebrafish(445309) family with sequence similarity 199, X-linked
cow(616201) family with sequence similarity 199, X-linked
domestic cat(101099533) family with sequence similarity 199, X-linked
chicken(422377) family with sequence similarity 199, X-linked
naked mole-rat(101701206) family with sequence similarity 199, X-linked
domestic guinea pig(100736215) family with sequence similarity 199, X-linked
sheep(101123014) family with sequence similarity 199, X-linked
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146261 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146261 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146261 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207318 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207318 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207318 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207318 Rosetta Predictions human pricing
NM_146261 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071953 predicted 805
2 SASI_Hs01_00071954 predicted 366
3 SASI_Hs01_00071955 predicted 1066
4 SASI_Hs01_00071956 predicted 519
5 SASI_Hs01_00071957 predicted 369
6 SASI_Hs01_00071958 predicted 831
7 SASI_Hs01_00071959 predicted 423
8 SASI_Hs01_00071960 predicted 364
9 SASI_Hs01_00071961 predicted 1157
10 SASI_Hs01_00071962 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146261 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172182 predicted 862
2 SASI_Mm01_00172183 predicted 924
3 SASI_Mm02_00342009 predicted 441
4 SASI_Mm01_00172184 predicted 1434
5 SASI_Mm01_00172185 predicted 700
6 SASI_Mm01_00172186 predicted 651
7 SASI_Mm01_00172187 predicted 810
8 SASI_Mm01_00172188 predicted 832
9 SASI_Mm01_00172189 predicted 790
10 SASI_Mm01_00172191 predicted 1358
11 SASI_Mm01_00172190 predicted 599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146261
FAM199X MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 199, X-linked
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146261.2-484s21c1
Sequence:CCGGCTCACTTCGTGTGGTACAAGTCTCGAGACTTGTACCACACGAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146261.2-838s21c1
Sequence:CCGGGATGAGCAGGTGGAATATATTCTCGAGAATATATTCCACCTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146261.2-528s21c1
Sequence:CCGGGGAGCTGTTCTCATCCGTTTCCTCGAGGAAACGGATGAGAACAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146261.2-1253s21c1
Sequence:CCGGCAGAGCGGATTCGGGATTCAACTCGAGTTGAATCCCGAATCCGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146261.1-632s1c1
Sequence:CCGGGATTGGTCAGATAGTGAATTTCTCGAGAAATTCACTATCTGACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215990    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146261.1-2256s1c1
Sequence:CCGGCTCTAAACTAGAACGTTTATCCTCGAGGATAAACGTTCTAGTTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146261.1-2693s1c1
Sequence:CCGGCACGGAGTTCAGAGGTTAATACTCGAGTATTAACCTCTGAACTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217680    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146261.1-2393s1c1
Sequence:CCGGGAGACTGCTGTGGGTATATAACTCGAGTTATATACCCACAGCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146261.2-973s21c1
Sequence:CCGGGAACTTAACTGTCTCACAGATCTCGAGATCTGTGAGACAGTTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146261.1-862s1c1
Sequence:CCGGCCGGGAGCAACTTGACATTATCTCGAGATAATGTCAAGTTGCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146261.1-609s1c1
Sequence:CCGGCCTCATCTATCAGCACGTACTCTCGAGAGTACGTGCTGATAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146261.1-761s1c1
Sequence:CCGGCACCGGAATCTAGATGAGCTTCTCGAGAAGCTCATCTAGATTCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146261.1-527s1c1
Sequence:CCGGGATGACTGCTACTCCCTGTTACTCGAGTAACAGGGAGTAGCAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146261.1-691s1c1
Sequence:CCGGCGATGTGCTTTCTGACGTCATCTCGAGATGACGTCAGAAAGCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146261
FAM199X MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 199, X-linked
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146261.2-484s21c1
Sequence:CCGGCTCACTTCGTGTGGTACAAGTCTCGAGACTTGTACCACACGAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146261.2-838s21c1
Sequence:CCGGGATGAGCAGGTGGAATATATTCTCGAGAATATATTCCACCTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146261.2-528s21c1
Sequence:CCGGGGAGCTGTTCTCATCCGTTTCCTCGAGGAAACGGATGAGAACAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146261.2-1253s21c1
Sequence:CCGGCAGAGCGGATTCGGGATTCAACTCGAGTTGAATCCCGAATCCGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146261.1-632s1c1
Sequence:CCGGGATTGGTCAGATAGTGAATTTCTCGAGAAATTCACTATCTGACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215990    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146261.1-2256s1c1
Sequence:CCGGCTCTAAACTAGAACGTTTATCCTCGAGGATAAACGTTCTAGTTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146261.1-2693s1c1
Sequence:CCGGCACGGAGTTCAGAGGTTAATACTCGAGTATTAACCTCTGAACTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217680    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146261.1-2393s1c1
Sequence:CCGGGAGACTGCTGTGGGTATATAACTCGAGTTATATACCCACAGCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146261.2-973s21c1
Sequence:CCGGGAACTTAACTGTCTCACAGATCTCGAGATCTGTGAGACAGTTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146261.1-862s1c1
Sequence:CCGGCCGGGAGCAACTTGACATTATCTCGAGATAATGTCAAGTTGCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146261.1-609s1c1
Sequence:CCGGCCTCATCTATCAGCACGTACTCTCGAGAGTACGTGCTGATAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146261.1-761s1c1
Sequence:CCGGCACCGGAATCTAGATGAGCTTCTCGAGAAGCTCATCTAGATTCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146261.1-527s1c1
Sequence:CCGGGATGACTGCTACTCCCTGTTACTCGAGTAACAGGGAGTAGCAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146261.1-691s1c1
Sequence:CCGGCGATGTGCTTTCTGACGTCATCTCGAGATGACGTCAGAAAGCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146261
FAM199X MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 199, X-linked
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146261.2-484s21c1
Sequence:CCGGCTCACTTCGTGTGGTACAAGTCTCGAGACTTGTACCACACGAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146261.2-838s21c1
Sequence:CCGGGATGAGCAGGTGGAATATATTCTCGAGAATATATTCCACCTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146261.2-528s21c1
Sequence:CCGGGGAGCTGTTCTCATCCGTTTCCTCGAGGAAACGGATGAGAACAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146261.2-1253s21c1
Sequence:CCGGCAGAGCGGATTCGGGATTCAACTCGAGTTGAATCCCGAATCCGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146261.1-632s1c1
Sequence:CCGGGATTGGTCAGATAGTGAATTTCTCGAGAAATTCACTATCTGACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215990    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146261.1-2256s1c1
Sequence:CCGGCTCTAAACTAGAACGTTTATCCTCGAGGATAAACGTTCTAGTTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146261.1-2693s1c1
Sequence:CCGGCACGGAGTTCAGAGGTTAATACTCGAGTATTAACCTCTGAACTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217680    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146261.1-2393s1c1
Sequence:CCGGGAGACTGCTGTGGGTATATAACTCGAGTTATATACCCACAGCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146261.2-973s21c1
Sequence:CCGGGAACTTAACTGTCTCACAGATCTCGAGATCTGTGAGACAGTTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146261.1-862s1c1
Sequence:CCGGCCGGGAGCAACTTGACATTATCTCGAGATAATGTCAAGTTGCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146261.1-609s1c1
Sequence:CCGGCCTCATCTATCAGCACGTACTCTCGAGAGTACGTGCTGATAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146261.1-761s1c1
Sequence:CCGGCACCGGAATCTAGATGAGCTTCTCGAGAAGCTCATCTAGATTCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146261.1-527s1c1
Sequence:CCGGGATGACTGCTACTCCCTGTTACTCGAGTAACAGGGAGTAGCAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146261.1-691s1c1
Sequence:CCGGCGATGTGCTTTCTGACGTCATCTCGAGATGACGTCAGAAAGCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207318
FAM199X MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 199, X-linked
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207318.2-1326s21c1
Sequence:CCGGTGATGTAATAAGGGTGAATTTCTCGAGAAATTCACCCTTATTACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207318.2-555s21c1
Sequence:CCCGATTGGTCAGATAGCGAGTTTGCTCGAGCAAACTCGCTATCTGACCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207318.2-1610s21c1
Sequence:CCGGTCTGATGCACAGTCTAGTTTACTCGAGTAAACTAGACTGTGCATCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207318.1-947s1c1
Sequence:CCGGGCCTGGAAGAGAAGCAACTTTCTCGAGAAAGTTGCTTCTCTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207318.1-1059s1c1
Sequence:CCGGCCAGTGTTGGAAACTCTGCTTCTCGAGAAGCAGAGTTTCCAACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207318.1-957s1c1
Sequence:CCGGGAAGCAACTTTAGTTGTGCAACTCGAGTTGCACAACTAAAGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207318.1-1276s1c1
Sequence:CCGGGCTGTCCTTGAAAGTGACTGACTCGAGTCAGTCACTTTCAAGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207318.1-463s1c1
Sequence:CCGGCCTGTTAGATGATCAGGACTTCTCGAGAAGTCCTGATCATCTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207318.1-860s1c1
Sequence:CCGGGAACTTAACTGTCTCACAGATCTCGAGATCTGTGAGACAGTTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207318
FAM199X MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 199, X-linked
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207318.2-1326s21c1
Sequence:CCGGTGATGTAATAAGGGTGAATTTCTCGAGAAATTCACCCTTATTACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207318.2-555s21c1
Sequence:CCCGATTGGTCAGATAGCGAGTTTGCTCGAGCAAACTCGCTATCTGACCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207318.2-1610s21c1
Sequence:CCGGTCTGATGCACAGTCTAGTTTACTCGAGTAAACTAGACTGTGCATCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207318.1-947s1c1
Sequence:CCGGGCCTGGAAGAGAAGCAACTTTCTCGAGAAAGTTGCTTCTCTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207318.1-1059s1c1
Sequence:CCGGCCAGTGTTGGAAACTCTGCTTCTCGAGAAGCAGAGTTTCCAACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207318.1-957s1c1
Sequence:CCGGGAAGCAACTTTAGTTGTGCAACTCGAGTTGCACAACTAAAGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207318.1-1276s1c1
Sequence:CCGGGCTGTCCTTGAAAGTGACTGACTCGAGTCAGTCACTTTCAAGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207318.1-463s1c1
Sequence:CCGGCCTGTTAGATGATCAGGACTTCTCGAGAAGTCCTGATCATCTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207318.1-860s1c1
Sequence:CCGGGAACTTAACTGTCTCACAGATCTCGAGATCTGTGAGACAGTTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207318
FAM199X MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 199, X-linked
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207318.2-1326s21c1
Sequence:CCGGTGATGTAATAAGGGTGAATTTCTCGAGAAATTCACCCTTATTACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207318.2-555s21c1
Sequence:CCCGATTGGTCAGATAGCGAGTTTGCTCGAGCAAACTCGCTATCTGACCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207318.2-1610s21c1
Sequence:CCGGTCTGATGCACAGTCTAGTTTACTCGAGTAAACTAGACTGTGCATCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207318.1-947s1c1
Sequence:CCGGGCCTGGAAGAGAAGCAACTTTCTCGAGAAAGTTGCTTCTCTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207318.1-1059s1c1
Sequence:CCGGCCAGTGTTGGAAACTCTGCTTCTCGAGAAGCAGAGTTTCCAACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207318.1-957s1c1
Sequence:CCGGGAAGCAACTTTAGTTGTGCAACTCGAGTTGCACAACTAAAGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207318.1-1276s1c1
Sequence:CCGGGCTGTCCTTGAAAGTGACTGACTCGAGTCAGTCACTTTCAAGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207318.1-463s1c1
Sequence:CCGGCCTGTTAGATGATCAGGACTTCTCGAGAAGTCCTGATCATCTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207318.1-860s1c1
Sequence:CCGGGAACTTAACTGTCTCACAGATCTCGAGATCTGTGAGACAGTTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks