EMAIL THIS PAGE TO A FRIEND

FAM19A1

family with sequence similarity 19 (chemokine (C-C motif)-like), member A1

164 Gene Product Result for
Synonyms: TAFA-1 TAFA1
UniProtKB ID: Q7Z5A9, A8K0V3, Q8TCL8
Gene ID:
Human(407738) Summary: This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines that act as regulators of immune and nervous cells. [provided by RefSeq, Jul 2008]
Mouse(320265) family with sequence similarity 19, member A1
Rat(500266) family with sequence similarity 19 (chemokine (C-C motif)-like), member A1
Zebrafish(100536837) family with sequence similarity 19 (chemokine (C-C motif)-like), member A1
chicken(416089) family with sequence similarity 19 (chemokine (C-C motif)-like), member A1
cow(782935) family with sequence similarity 19 (chemokine (C-C motif)-like), member A1
domestic cat(101091180) family with sequence similarity 19 (chemokine (C-C motif)-like), member A1
dog(611001) family with sequence similarity 19 (chemokine (C-C motif)-like), member A1
sheep(101117369) family with sequence similarity 19 (chemokine (C-C motif)-like), member A1
domestic guinea pig(100730751) family with sequence similarity 19 (chemokine (C-C motif)-like), member A1
naked mole-rat(101714655) family with sequence similarity 19 (chemokine (C-C motif)-like), member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1733 Human TAFA1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_213609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_213609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_213609 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_213609 Rosetta Predictions human pricing
XM_001077118 Rosetta Predictions rat pricing
XM_575616 Rosetta Predictions rat pricing
NM_182808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216763 predicted 646
2 SASI_Hs01_00216764 predicted 711
3 SASI_Hs01_00216766 predicted 725
4 SASI_Hs02_00374295 predicted 852
5 SASI_Hs02_00374296 predicted 859
6 SASI_Hs01_00216768 predicted 793
7 SASI_Hs01_00216769 predicted 713
8 SASI_Hs02_00374297 predicted 799
9 SASI_Hs02_00374298 predicted 843
10 SASI_Hs02_00374299 predicted 651
11 SASI_Hs01_00216765 predicted 562
12 SASI_Hs01_00216767 predicted 533
13 SASI_Hs01_00216770 predicted 547
14 SASI_Hs01_00216771 predicted 780
15 SASI_Hs01_00216772 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355874 predicted 535
2 SASI_Rn02_00355875 predicted 397
3 SASI_Rn02_00355876 predicted 429
4 SASI_Rn02_00355877 predicted 459
5 SASI_Rn02_00355878 predicted 484
6 SASI_Rn02_00355879 predicted 434
7 SASI_Rn02_00355880 predicted 563
8 SASI_Rn02_00355881 predicted 425
9 SASI_Rn02_00355882 predicted 559
10 SASI_Rn02_00355883 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575616 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403923 predicted 230
2 SASI_Rn02_00403924 predicted 241
3 SASI_Rn02_00403925 predicted 205
4 SASI_Rn02_00403926 predicted 239
5 SASI_Rn02_00403927 predicted 216
6 SASI_Rn02_00403928 predicted 252
7 SASI_Rn02_00403929 predicted 203
8 SASI_Rn02_00403930 predicted 225
9 SASI_Rn02_00403931 predicted 235
10 SASI_Rn02_00403932 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028781 predicted 686
2 SASI_Mm01_00028782 predicted 757
3 SASI_Mm01_00028783 predicted 598
4 SASI_Mm02_00349976 predicted 780
5 SASI_Mm01_00028784 predicted 765
6 SASI_Mm01_00028785 predicted 775
7 SASI_Mm01_00028786 predicted 816
8 SASI_Mm01_00028787 predicted 496
9 SASI_Mm01_00028788 predicted 736
10 SASI_Mm01_00028789 predicted 788
11 SASI_Mm01_00028790 predicted 611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182808
FAM19A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 19 (chemokine (C-C motif)-like), member A1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182808.1-276s1c1
Sequence:CCGGGTGGATAAGTGCTTGTGCGATCTCGAGATCGCACAAGCACTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182808.1-467s1c1
Sequence:CCGGCAACAAGAAACCGACCTTCCTCTCGAGAGGAAGGTCGGTTTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182808.1-418s1c1
Sequence:CCGGCGGTCACAAACAGTGAAGTGTCTCGAGACACTTCACTGTTTGTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182808.1-585s1c1
Sequence:CCGGGATGTGTGCTACAGGCAACAACTCGAGTTGTTGCCTGTAGCACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182808.1-390s1c1
Sequence:CCGGGTGTTGTAACAAGAACCGCATCTCGAGATGCGGTTCTTGTTACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182808
FAM19A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 19 (chemokine (C-C motif)-like), member A1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182808.1-276s1c1
Sequence:CCGGGTGGATAAGTGCTTGTGCGATCTCGAGATCGCACAAGCACTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182808.1-467s1c1
Sequence:CCGGCAACAAGAAACCGACCTTCCTCTCGAGAGGAAGGTCGGTTTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182808.1-418s1c1
Sequence:CCGGCGGTCACAAACAGTGAAGTGTCTCGAGACACTTCACTGTTTGTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182808.1-585s1c1
Sequence:CCGGGATGTGTGCTACAGGCAACAACTCGAGTTGTTGCCTGTAGCACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182808.1-390s1c1
Sequence:CCGGGTGTTGTAACAAGAACCGCATCTCGAGATGCGGTTCTTGTTACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182808
FAM19A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 19 (chemokine (C-C motif)-like), member A1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182808.1-276s1c1
Sequence:CCGGGTGGATAAGTGCTTGTGCGATCTCGAGATCGCACAAGCACTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182808.1-467s1c1
Sequence:CCGGCAACAAGAAACCGACCTTCCTCTCGAGAGGAAGGTCGGTTTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182808.1-418s1c1
Sequence:CCGGCGGTCACAAACAGTGAAGTGTCTCGAGACACTTCACTGTTTGTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182808.1-585s1c1
Sequence:CCGGGATGTGTGCTACAGGCAACAACTCGAGTTGTTGCCTGTAGCACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182808.1-390s1c1
Sequence:CCGGGTGTTGTAACAAGAACCGCATCTCGAGATGCGGTTCTTGTTACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213609
FAM19A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 19 (chemokine (C-C motif)-like), member A1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213609.2-622s1c1
Sequence:CCGGGAACAACAAGAAACCGGCCTTCTCGAGAAGGCCGGTTTCTTGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213609.2-708s1c1
Sequence:CCGGGAAGAATGTAAGACACTCCCTCTCGAGAGGGAGTGTCTTACATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213609.2-721s1c1
Sequence:CCGGCACTCCCTGACAATTCTGGATCTCGAGATCCAGAATTGTCAGGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_213609.2-916s1c1
Sequence:CCGGCCAGATAATCACAGTGCGTTTCTCGAGAAACGCACTGTGATTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166897    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_213609.2-1627s1c1
Sequence:CCGGCCTACATGAATAAGTCCTGTACTCGAGTACAGGACTTATTCATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213609
FAM19A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 19 (chemokine (C-C motif)-like), member A1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213609.2-622s1c1
Sequence:CCGGGAACAACAAGAAACCGGCCTTCTCGAGAAGGCCGGTTTCTTGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213609.2-708s1c1
Sequence:CCGGGAAGAATGTAAGACACTCCCTCTCGAGAGGGAGTGTCTTACATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213609.2-721s1c1
Sequence:CCGGCACTCCCTGACAATTCTGGATCTCGAGATCCAGAATTGTCAGGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_213609.2-916s1c1
Sequence:CCGGCCAGATAATCACAGTGCGTTTCTCGAGAAACGCACTGTGATTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166897    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_213609.2-1627s1c1
Sequence:CCGGCCTACATGAATAAGTCCTGTACTCGAGTACAGGACTTATTCATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213609
FAM19A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 19 (chemokine (C-C motif)-like), member A1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213609.2-622s1c1
Sequence:CCGGGAACAACAAGAAACCGGCCTTCTCGAGAAGGCCGGTTTCTTGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213609.2-708s1c1
Sequence:CCGGGAAGAATGTAAGACACTCCCTCTCGAGAGGGAGTGTCTTACATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213609.2-721s1c1
Sequence:CCGGCACTCCCTGACAATTCTGGATCTCGAGATCCAGAATTGTCAGGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_213609.2-916s1c1
Sequence:CCGGCCAGATAATCACAGTGCGTTTCTCGAGAAACGCACTGTGATTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166897    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_213609.2-1627s1c1
Sequence:CCGGCCTACATGAATAAGTCCTGTACTCGAGTACAGGACTTATTCATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks