EMAIL THIS PAGE TO A FRIEND

FAM19A2

family with sequence similarity 19 (chemokine (C-C motif)-like), member A2

Synonyms: TAFA-2 TAFA2
UniProtKB ID: Q8N3H0, B3KVV4, Q4G0R9, Q68DK0, Q6GTX6
Gene ID:
Human(338811) Summary: This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines, that act as regulators of immune and nervous cells. [provided by RefSeq, Jul 2008]
Mouse(268354) family with sequence similarity 19, member A2
Rat(680647) family with sequence similarity 19 (chemokine (C-C motif)-like), member A2
domestic guinea pig(100735306) family with sequence similarity 19 (chemokine (C-C motif)-like), member A2
sheep(101113575) family with sequence similarity 19 (chemokine (C-C motif)-like), member A2
chicken(771745) family with sequence similarity 19 (chemokine (C-C motif)-like), member A2
dog(607990) family with sequence similarity 19 (chemokine (C-C motif)-like), member A2
cow(100297656) family with sequence similarity 19 (chemokine (C-C motif)-like), member A2
208 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301335 ANTI-FAM19A2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1734 Human TAFA2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178539 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178539 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178539 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052481 MISSION® esiRNA esiRNA human FAM19A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178539 Rosetta Predictions human pricing
XM_001058142 Rosetta Predictions rat pricing
NM_182807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038169 predicted 2011
2 SASI_Hs01_00038170 predicted 2081
3 SASI_Hs01_00038171 predicted 1939
4 SASI_Hs01_00038172 predicted 1636
5 SASI_Hs01_00038174 predicted 1953
6 SASI_Hs01_00038175 predicted 1934
7 SASI_Hs02_00369775 predicted 1763
8 SASI_Hs01_00038176 predicted 1653
9 SASI_Hs01_00038177 predicted 2115
10 SASI_Hs01_00038178 predicted 1786
11 SASI_Hs01_00038173 predicted 1671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288715 predicted 439
2 SASI_Rn02_00288716 predicted 523
3 SASI_Rn02_00288717 predicted 489
4 SASI_Rn02_00288718 predicted 549
5 SASI_Rn02_00288719 predicted 470
6 SASI_Rn02_00288720 predicted 530
7 SASI_Rn02_00288721 predicted 463
8 SASI_Rn02_00288722 predicted 246
9 SASI_Rn02_00288723 predicted 579
10 SASI_Rn02_00288724 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090589 predicted 2158
2 SASI_Mm01_00090590 predicted 1843
3 SASI_Mm01_00090591 predicted 2098
4 SASI_Mm02_00349975 predicted 1829
5 SASI_Mm01_00090592 predicted 2059
6 SASI_Mm01_00090593 predicted 2223
7 SASI_Mm01_00090594 predicted 2194
8 SASI_Mm01_00090595 predicted 2511
9 SASI_Mm01_00090596 predicted 1773
10 SASI_Mm01_00090597 predicted 1679
11 SASI_Mm01_00090598 predicted 1833
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182807
FAM19A2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 19 (chemokine (C-C motif)-like), member A2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182807.1-459s1c1
Sequence:CCGGCAACCATCACAAAGCTCACCACTCGAGTGGTGAGCTTTGTGATGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182807.1-521s1c1
Sequence:CCGGGCTGTAATAAGAACAAGATAGCTCGAGCTATCTTGTTCTTATTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182807.1-719s1c1
Sequence:CCGGGTTCCTCTGGAAACAAAGTAACTCGAGTTACTTTGTTTCCAGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182807.1-509s1c1
Sequence:CCGGCGCTGCACAGATGCTGTAATACTCGAGTATTACAGCATCTGTGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182807.1-622s1c1
Sequence:CCGGGATGCATCCATAGTGGAACAACTCGAGTTGTTCCACTATGGATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182807.1-714s1c1
Sequence:CCGGGAGCTGTTCCTCTGGAAACAACTCGAGTTGTTTCCAGAGGAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182807.1-397s1c1
Sequence:CCGGCAAGGAAAGCTTCTGATAATTCTCGAGAATTATCAGAAGCTTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215875    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182807.2-2660s1c1
Sequence:CCGGCATCGATAATGATAATCATTGCTCGAGCAATGATTATCATTATCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182807
FAM19A2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 19 (chemokine (C-C motif)-like), member A2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182807.1-459s1c1
Sequence:CCGGCAACCATCACAAAGCTCACCACTCGAGTGGTGAGCTTTGTGATGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182807.1-521s1c1
Sequence:CCGGGCTGTAATAAGAACAAGATAGCTCGAGCTATCTTGTTCTTATTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182807.1-719s1c1
Sequence:CCGGGTTCCTCTGGAAACAAAGTAACTCGAGTTACTTTGTTTCCAGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182807.1-509s1c1
Sequence:CCGGCGCTGCACAGATGCTGTAATACTCGAGTATTACAGCATCTGTGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182807.1-622s1c1
Sequence:CCGGGATGCATCCATAGTGGAACAACTCGAGTTGTTCCACTATGGATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182807.1-714s1c1
Sequence:CCGGGAGCTGTTCCTCTGGAAACAACTCGAGTTGTTTCCAGAGGAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182807.1-397s1c1
Sequence:CCGGCAAGGAAAGCTTCTGATAATTCTCGAGAATTATCAGAAGCTTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215875    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182807.2-2660s1c1
Sequence:CCGGCATCGATAATGATAATCATTGCTCGAGCAATGATTATCATTATCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182807
FAM19A2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 19 (chemokine (C-C motif)-like), member A2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182807.1-459s1c1
Sequence:CCGGCAACCATCACAAAGCTCACCACTCGAGTGGTGAGCTTTGTGATGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182807.1-521s1c1
Sequence:CCGGGCTGTAATAAGAACAAGATAGCTCGAGCTATCTTGTTCTTATTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182807.1-719s1c1
Sequence:CCGGGTTCCTCTGGAAACAAAGTAACTCGAGTTACTTTGTTTCCAGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182807.1-509s1c1
Sequence:CCGGCGCTGCACAGATGCTGTAATACTCGAGTATTACAGCATCTGTGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182807.1-622s1c1
Sequence:CCGGGATGCATCCATAGTGGAACAACTCGAGTTGTTCCACTATGGATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182807.1-714s1c1
Sequence:CCGGGAGCTGTTCCTCTGGAAACAACTCGAGTTGTTTCCAGAGGAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182807.1-397s1c1
Sequence:CCGGCAAGGAAAGCTTCTGATAATTCTCGAGAATTATCAGAAGCTTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215875    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182807.2-2660s1c1
Sequence:CCGGCATCGATAATGATAATCATTGCTCGAGCAATGATTATCATTATCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178539
FAM19A2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 19 (chemokine (C-C motif)-like), member A2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178539.2-1076s1c1
Sequence:CCGGGCACTCCACAGATGCTGTAATCTCGAGATTACAGCATCTGTGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178539.2-1193s1c1
Sequence:CCGGGCTTCAATAGTGGAACAGAAACTCGAGTTTCTGTTCCACTATTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178539.2-1031s1c1
Sequence:CCGGCATCATAAAGCTCACCATGTTCTCGAGAACATGGTGAGCTTTATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178539.2-1284s1c1
Sequence:CCGGGCTGTTCCTCTGGGAATAAAGCTCGAGCTTTATTCCCAGAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178539.2-1119s1c1
Sequence:CCGGCACAAACAGTCAAGTGCTCCTCTCGAGAGGAGCACTTGACTGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178539.2-1030s1c1
Sequence:CCGGCCATCATAAAGCTCACCATGTCTCGAGACATGGTGAGCTTTATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178539.2-1250s1c1
Sequence:CCGGGAATGTAAAGTTCTTCCGGATCTCGAGATCCGGAAGAACTTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178539.2-1009s1c1
Sequence:CCGGGAAAGTTGTATCCAGTGCAAACTCGAGTTTGCACTGGATACAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178539.2-1187s1c1
Sequence:CCGGGTGGATGCTTCAATAGTGGAACTCGAGTTCCACTATTGAAGCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178539
FAM19A2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 19 (chemokine (C-C motif)-like), member A2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178539.2-1076s1c1
Sequence:CCGGGCACTCCACAGATGCTGTAATCTCGAGATTACAGCATCTGTGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178539.2-1193s1c1
Sequence:CCGGGCTTCAATAGTGGAACAGAAACTCGAGTTTCTGTTCCACTATTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178539.2-1031s1c1
Sequence:CCGGCATCATAAAGCTCACCATGTTCTCGAGAACATGGTGAGCTTTATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178539.2-1284s1c1
Sequence:CCGGGCTGTTCCTCTGGGAATAAAGCTCGAGCTTTATTCCCAGAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178539.2-1119s1c1
Sequence:CCGGCACAAACAGTCAAGTGCTCCTCTCGAGAGGAGCACTTGACTGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178539.2-1030s1c1
Sequence:CCGGCCATCATAAAGCTCACCATGTCTCGAGACATGGTGAGCTTTATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178539.2-1250s1c1
Sequence:CCGGGAATGTAAAGTTCTTCCGGATCTCGAGATCCGGAAGAACTTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178539.2-1009s1c1
Sequence:CCGGGAAAGTTGTATCCAGTGCAAACTCGAGTTTGCACTGGATACAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178539.2-1187s1c1
Sequence:CCGGGTGGATGCTTCAATAGTGGAACTCGAGTTCCACTATTGAAGCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178539
FAM19A2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 19 (chemokine (C-C motif)-like), member A2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178539.2-1076s1c1
Sequence:CCGGGCACTCCACAGATGCTGTAATCTCGAGATTACAGCATCTGTGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178539.2-1193s1c1
Sequence:CCGGGCTTCAATAGTGGAACAGAAACTCGAGTTTCTGTTCCACTATTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178539.2-1031s1c1
Sequence:CCGGCATCATAAAGCTCACCATGTTCTCGAGAACATGGTGAGCTTTATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178539.2-1284s1c1
Sequence:CCGGGCTGTTCCTCTGGGAATAAAGCTCGAGCTTTATTCCCAGAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178539.2-1119s1c1
Sequence:CCGGCACAAACAGTCAAGTGCTCCTCTCGAGAGGAGCACTTGACTGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178539.2-1030s1c1
Sequence:CCGGCCATCATAAAGCTCACCATGTCTCGAGACATGGTGAGCTTTATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178539.2-1250s1c1
Sequence:CCGGGAATGTAAAGTTCTTCCGGATCTCGAGATCCGGAAGAACTTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178539.2-1009s1c1
Sequence:CCGGGAAAGTTGTATCCAGTGCAAACTCGAGTTTGCACTGGATACAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178539.2-1187s1c1
Sequence:CCGGGTGGATGCTTCAATAGTGGAACTCGAGTTCCACTATTGAAGCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks