EMAIL THIS PAGE TO A FRIEND

FAM19A3

family with sequence similarity 19 (chemokine (C-C motif)-like), member A3

55 Gene Product Result for
Synonyms: TAFA-3 TAFA3
UniProtKB ID: Q7Z5A8, B7ZLU0, Q2M1P9, Q7Z5A6
Gene ID:
Human(284467) Summary: This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines, that act as regulators of immune and nervous cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(329731) family with sequence similarity 19, member A3
Rat(691123) family with sequence similarity 19 (chemokine (C-C motif)-like), member A3
chicken(419874) family with sequence similarity 19 (chemokine (C-C motif)-like), member A3
cow(510868) family with sequence similarity 19 (chemokine (C-C motif)-like), member A3
domestic cat(101098809) family with sequence similarity 19 (chemokine (C-C motif)-like), member A3
sheep(101107758) family with sequence similarity 19 (chemokine (C-C motif)-like), member A3
domestic guinea pig(100727076) family with sequence similarity 19 (chemokine (C-C motif)-like), member A3
naked mole-rat(101707733) family with sequence similarity 19 (chemokine (C-C motif)-like), member A3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183224 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183224 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183224 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001004440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004440 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004440 Rosetta Predictions human pricing
NM_182759 Rosetta Predictions human pricing
XM_001076902 Rosetta Predictions rat pricing
NM_183224 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163926 predicted 640
2 SASI_Hs01_00163927 predicted 496
3 SASI_Hs01_00163928 predicted 563
4 SASI_Hs01_00163929 predicted 692
5 SASI_Hs01_00163930 predicted 629
6 SASI_Hs01_00163931 predicted 897
7 SASI_Hs01_00163932 predicted 576
8 SASI_Hs01_00163933 predicted 590
9 SASI_Hs02_00304591 predicted 695
10 SASI_Hs01_00163934 predicted 511
11 SASI_Hs01_00163935 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093564 predicted 567
2 SASI_Hs01_00093565 predicted 425
3 SASI_Hs01_00093567 predicted 500
4 SASI_Hs01_00093568 predicted 625
5 SASI_Hs01_00093569 predicted 558
6 SASI_Hs01_00093570 predicted 830
7 SASI_Hs01_00093571 predicted 508
8 SASI_Hs01_00093572 predicted 522
9 SASI_Hs01_00093573 predicted 625
10 SASI_Hs02_00370918 predicted 446
11 SASI_Hs01_00093566 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354969 predicted 312
2 SASI_Rn02_00354970 predicted 261
3 SASI_Rn02_00354971 predicted 348
4 SASI_Rn02_00354972 predicted 295
5 SASI_Rn02_00354973 predicted 224
6 SASI_Rn02_00354974 predicted 350
7 SASI_Rn02_00354975 predicted 440
8 SASI_Rn02_00354976 predicted 290
9 SASI_Rn02_00354977 predicted 313
10 SASI_Rn02_00354978 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183224 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158239 predicted 1175
2 SASI_Mm01_00158240 predicted 1272
3 SASI_Mm01_00158241 predicted 1184
4 SASI_Mm01_00158242 predicted 1278
5 SASI_Mm01_00158243 predicted 1155
6 SASI_Mm01_00158244 predicted 1180
7 SASI_Mm01_00158245 predicted 738
8 SASI_Mm01_00158246 predicted 1333
9 SASI_Mm01_00158247 predicted 1358
10 SASI_Mm01_00158248 predicted 1393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183224
FAM19A3 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 19 (chemokine (C-C motif)-like), member A3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-749s21c1
Sequence:CCGGTGCAACCGGAACCGCATTGAGCTCGAGCTCAATGCGGTTCCGGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183224.2-1229s21c1
Sequence:CCGGGGAATATCTTGTCAAGTTAAGCTCGAGCTTAACTTGACAAGATATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-947s21c1
Sequence:CCGGAGCAGTGGACACAAGGTCAAACTCGAGTTTGACCTTGTGTCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183224.2-2247s21c1
Sequence:CCGGAGGTAAATCAGCCATAGTTTACTCGAGTAAACTATGGCTGATTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-982s21c1
Sequence:CCGGACGGTAACTCTCGGAGGTCATCTCGAGATGACCTCCGAGAGTTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-896s21c1
Sequence:CCGGCTGCTGGGAGAGGAGTGTAAGCTCGAGCTTACACTCCTCTCCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-692s21c1
Sequence:CCGGACATCCGCAGTCCTAGTGAAGCTCGAGCTTCACTAGGACTGCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-865s21c1
Sequence:CCGGGCAGAAGTGGTGGTGTCAGATCTCGAGATCTGACACCACCACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184233    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183224.2-3128s1c1
Sequence:CCGGGCCATGCATTTAGTGGGTGAACTCGAGTTCACCCACTAAATGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183224.2-1512s1c1
Sequence:CCGGGCACTGGAAAGTAGAGATGAACTCGAGTTCATCTCTACTTTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179122    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183224.2-1814s1c1
Sequence:CCGGCCAACATGATTCTTGGGAGATCTCGAGATCTCCCAAGAATCATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183224
FAM19A3 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 19 (chemokine (C-C motif)-like), member A3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-749s21c1
Sequence:CCGGTGCAACCGGAACCGCATTGAGCTCGAGCTCAATGCGGTTCCGGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183224.2-1229s21c1
Sequence:CCGGGGAATATCTTGTCAAGTTAAGCTCGAGCTTAACTTGACAAGATATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-947s21c1
Sequence:CCGGAGCAGTGGACACAAGGTCAAACTCGAGTTTGACCTTGTGTCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183224.2-2247s21c1
Sequence:CCGGAGGTAAATCAGCCATAGTTTACTCGAGTAAACTATGGCTGATTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-982s21c1
Sequence:CCGGACGGTAACTCTCGGAGGTCATCTCGAGATGACCTCCGAGAGTTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-896s21c1
Sequence:CCGGCTGCTGGGAGAGGAGTGTAAGCTCGAGCTTACACTCCTCTCCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-692s21c1
Sequence:CCGGACATCCGCAGTCCTAGTGAAGCTCGAGCTTCACTAGGACTGCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-865s21c1
Sequence:CCGGGCAGAAGTGGTGGTGTCAGATCTCGAGATCTGACACCACCACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184233    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183224.2-3128s1c1
Sequence:CCGGGCCATGCATTTAGTGGGTGAACTCGAGTTCACCCACTAAATGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183224.2-1512s1c1
Sequence:CCGGGCACTGGAAAGTAGAGATGAACTCGAGTTCATCTCTACTTTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179122    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183224.2-1814s1c1
Sequence:CCGGCCAACATGATTCTTGGGAGATCTCGAGATCTCCCAAGAATCATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183224
FAM19A3 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 19 (chemokine (C-C motif)-like), member A3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-749s21c1
Sequence:CCGGTGCAACCGGAACCGCATTGAGCTCGAGCTCAATGCGGTTCCGGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183224.2-1229s21c1
Sequence:CCGGGGAATATCTTGTCAAGTTAAGCTCGAGCTTAACTTGACAAGATATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-947s21c1
Sequence:CCGGAGCAGTGGACACAAGGTCAAACTCGAGTTTGACCTTGTGTCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183224.2-2247s21c1
Sequence:CCGGAGGTAAATCAGCCATAGTTTACTCGAGTAAACTATGGCTGATTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-982s21c1
Sequence:CCGGACGGTAACTCTCGGAGGTCATCTCGAGATGACCTCCGAGAGTTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-896s21c1
Sequence:CCGGCTGCTGGGAGAGGAGTGTAAGCTCGAGCTTACACTCCTCTCCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-692s21c1
Sequence:CCGGACATCCGCAGTCCTAGTGAAGCTCGAGCTTCACTAGGACTGCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183224.2-865s21c1
Sequence:CCGGGCAGAAGTGGTGGTGTCAGATCTCGAGATCTGACACCACCACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184233    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183224.2-3128s1c1
Sequence:CCGGGCCATGCATTTAGTGGGTGAACTCGAGTTCACCCACTAAATGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183224.2-1512s1c1
Sequence:CCGGGCACTGGAAAGTAGAGATGAACTCGAGTTCATCTCTACTTTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179122    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183224.2-1814s1c1
Sequence:CCGGCCAACATGATTCTTGGGAGATCTCGAGATCTCCCAAGAATCATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004440
FAM19A3 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 19 (chemokine (C-C motif)-like), member A3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004440.1-524s1c1
Sequence:CCGGCAAGGTCACACGATAGCTCTTCTCGAGAAGAGCTATCGTGTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-708s1c1
Sequence:CCGGGATCTGCAATCACATACCTAACTCGAGTTAGGTATGTGATTGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162171    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-793s1c1
Sequence:CCGGCAGTTGAATTGGAGAGTTGATCTCGAGATCAACTCTCCAATTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162259    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-945s1c1
Sequence:CCGGCATAGAAACAAGAGGTCACATCTCGAGATGTGACCTCTTGTTTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-581s1c1
Sequence:CCGGCCGTGAACTGAAGAATGGTATCTCGAGATACCATTCTTCAGTTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-762s1c1
Sequence:CCGGCAACACACAATTCCTGCCCTTCTCGAGAAGGGCAGGAATTGTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164886    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-690s1c1
Sequence:CCGGGCTCAGCAGATATGGATGGATCTCGAGATCCATCCATATCTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165073    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-640s1c1
Sequence:CCGGGCCTCATGTCAAATGCAGCATCTCGAGATGCTGCATTTGACATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-912s1c1
Sequence:CCGGCCACAGTTCTTCAGATACCCTCTCGAGAGGGTATCTGAAGAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004440.1-497s1c1
Sequence:CCGGCAGCAGTGGACACAAAGTCAACTCGAGTTGACTTTGTGTCCACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165072    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-580s1c1
Sequence:CCGGGCCGTGAACTGAAGAATGGTACTCGAGTACCATTCTTCAGTTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004440.1-264s1c1
Sequence:CCGGGACGGTGAAATGCTCCTGTTTCTCGAGAAACAGGAGCATTTCACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165968    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-777s1c1
Sequence:CCGGGCCCTTAAGGAATGTCCAGTTCTCGAGAACTGGACATTCCTTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004440
FAM19A3 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 19 (chemokine (C-C motif)-like), member A3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004440.1-524s1c1
Sequence:CCGGCAAGGTCACACGATAGCTCTTCTCGAGAAGAGCTATCGTGTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-708s1c1
Sequence:CCGGGATCTGCAATCACATACCTAACTCGAGTTAGGTATGTGATTGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162171    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-793s1c1
Sequence:CCGGCAGTTGAATTGGAGAGTTGATCTCGAGATCAACTCTCCAATTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162259    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-945s1c1
Sequence:CCGGCATAGAAACAAGAGGTCACATCTCGAGATGTGACCTCTTGTTTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-581s1c1
Sequence:CCGGCCGTGAACTGAAGAATGGTATCTCGAGATACCATTCTTCAGTTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-762s1c1
Sequence:CCGGCAACACACAATTCCTGCCCTTCTCGAGAAGGGCAGGAATTGTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164886    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-690s1c1
Sequence:CCGGGCTCAGCAGATATGGATGGATCTCGAGATCCATCCATATCTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165073    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-640s1c1
Sequence:CCGGGCCTCATGTCAAATGCAGCATCTCGAGATGCTGCATTTGACATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-912s1c1
Sequence:CCGGCCACAGTTCTTCAGATACCCTCTCGAGAGGGTATCTGAAGAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004440.1-497s1c1
Sequence:CCGGCAGCAGTGGACACAAAGTCAACTCGAGTTGACTTTGTGTCCACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165072    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-580s1c1
Sequence:CCGGGCCGTGAACTGAAGAATGGTACTCGAGTACCATTCTTCAGTTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004440.1-264s1c1
Sequence:CCGGGACGGTGAAATGCTCCTGTTTCTCGAGAAACAGGAGCATTTCACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165968    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-777s1c1
Sequence:CCGGGCCCTTAAGGAATGTCCAGTTCTCGAGAACTGGACATTCCTTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004440
FAM19A3 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 19 (chemokine (C-C motif)-like), member A3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004440.1-524s1c1
Sequence:CCGGCAAGGTCACACGATAGCTCTTCTCGAGAAGAGCTATCGTGTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-708s1c1
Sequence:CCGGGATCTGCAATCACATACCTAACTCGAGTTAGGTATGTGATTGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162171    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-793s1c1
Sequence:CCGGCAGTTGAATTGGAGAGTTGATCTCGAGATCAACTCTCCAATTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162259    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-945s1c1
Sequence:CCGGCATAGAAACAAGAGGTCACATCTCGAGATGTGACCTCTTGTTTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-581s1c1
Sequence:CCGGCCGTGAACTGAAGAATGGTATCTCGAGATACCATTCTTCAGTTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-762s1c1
Sequence:CCGGCAACACACAATTCCTGCCCTTCTCGAGAAGGGCAGGAATTGTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164886    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-690s1c1
Sequence:CCGGGCTCAGCAGATATGGATGGATCTCGAGATCCATCCATATCTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165073    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-640s1c1
Sequence:CCGGGCCTCATGTCAAATGCAGCATCTCGAGATGCTGCATTTGACATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-912s1c1
Sequence:CCGGCCACAGTTCTTCAGATACCCTCTCGAGAGGGTATCTGAAGAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004440.1-497s1c1
Sequence:CCGGCAGCAGTGGACACAAAGTCAACTCGAGTTGACTTTGTGTCCACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165072    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-580s1c1
Sequence:CCGGGCCGTGAACTGAAGAATGGTACTCGAGTACCATTCTTCAGTTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004440.1-264s1c1
Sequence:CCGGGACGGTGAAATGCTCCTGTTTCTCGAGAAACAGGAGCATTTCACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165968    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004440.1-777s1c1
Sequence:CCGGGCCCTTAAGGAATGTCCAGTTCTCGAGAACTGGACATTCCTTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks