EMAIL THIS PAGE TO A FRIEND

FAM19A4

family with sequence similarity 19 (chemokine (C-C motif)-like), member A4

Synonyms: TAFA-4 TAFA4
UniProtKB ID: Q96LR4, A8MVT2
Gene ID:
Human(151647) Summary: This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines, that act as regulators of immune and nervous cells. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(320701) family with sequence similarity 19, member A4
Rat(689043) family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
naked mole-rat(101719160) family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
domestic guinea pig(100720630) family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
sheep(101105859) family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
chicken(771511) family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
domestic cat(101089425) family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
dog(610997) family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
cow(616873) family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1103479 Anti-FAM19A4 (39-52) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2105588 Anti-FAM19A4 antibody produced in rabbit affinity isolated antibody horse, guinea pig, rabbit, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177233 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177233 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177233 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001005527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005527 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011101 MISSION® esiRNA esiRNA targeting human FAM19A4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005527 Rosetta Predictions human pricing
NM_182522 Rosetta Predictions human pricing
NM_001134700 Rosetta Predictions rat pricing
NM_177233 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047420 predicted 1084
2 SASI_Hs01_00047421 predicted 764
3 SASI_Hs01_00047422 predicted 1044
4 SASI_Hs02_00304989 predicted 879
5 SASI_Hs01_00047423 predicted 1071
6 SASI_Hs01_00047424 predicted 553
7 SASI_Hs01_00047425 predicted 703
8 SASI_Hs01_00047426 predicted 1045
9 SASI_Hs01_00047427 predicted 535
10 SASI_Hs01_00047428 predicted 756
11 SASI_Hs01_00047429 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131755 predicted 1171
2 SASI_Hs01_00131756 predicted 847
3 SASI_Hs01_00131757 predicted 1131
4 SASI_Hs02_00370613 predicted 968
5 SASI_Hs01_00131758 predicted 1161
6 SASI_Hs01_00131759 predicted 632
7 SASI_Hs01_00131760 predicted 782
8 SASI_Hs01_00131761 predicted 1130
9 SASI_Hs01_00131762 predicted 622
10 SASI_Hs01_00131763 predicted 844
11 SASI_Hs01_00131764 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258019 predicted 863
2 SASI_Rn02_00258020 predicted 736
3 SASI_Rn02_00258021 predicted 935
4 SASI_Rn02_00258022 predicted 1120
5 SASI_Rn02_00258023 predicted 469
6 SASI_Rn02_00258024 predicted 1240
7 SASI_Rn02_00258025 predicted 1188
8 SASI_Rn02_00258026 predicted 857
9 SASI_Rn02_00258027 predicted 653
10 SASI_Rn02_00258028 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023307 predicted 473
2 SASI_Mm01_00023308 predicted 1274
3 SASI_Mm01_00023309 predicted 1255
4 SASI_Mm01_00023311 predicted 1048
5 SASI_Mm02_00347263 predicted 1252
6 SASI_Mm01_00023313 predicted 1238
7 SASI_Mm02_00347264 predicted 1047
8 SASI_Mm02_00347265 predicted 1262
9 SASI_Mm01_00023314 predicted 765
10 SASI_Mm02_00347266 predicted 586
11 SASI_Mm01_00023310 predicted 1023
12 SASI_Mm01_00023312 predicted 1234
13 SASI_Mm01_00023315 predicted 993
14 SASI_Mm01_00023316 predicted 435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177233
FAM19A4 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179288    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177233.4-927s1c1
Sequence:CCGGGCTCAGAAGTTCATAGCCAAACTCGAGTTTGGCTATGAACTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177233.4-672s1c1
Sequence:CCGGGCACAGCCTTCTTGTGTTGAACTCGAGTTCAACACAAGAAGGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177233.4-587s1c1
Sequence:CCGGCTGCTGCAATAAGAACCGCATCTCGAGATGCGGTTCTTATTGCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177233.5-465s1c1
Sequence:CCGGGTTCTGACCTATGTGTTAATGCTCGAGCATTAACACATAGGTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177233.5-1284s21c1
Sequence:CCGGATACGTGTGTTCTAGATTAAACTCGAGTTTAATCTAGAACACACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177233.5-688s21c1
Sequence:CCGGTTGAAGCTGCCATTGTGATTGCTCGAGCAATCACAATGGCAGCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177233.5-465s21c1
Sequence:CCGGGTTCTGACCTATGTGTTAATGCTCGAGCATTAACACATAGGTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177233.5-738s21c1
Sequence:CCGGTTGGAAGGAGAGGACTGTAAACTCGAGTTTACAGTCCTCTCCTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177233.5-783s21c1
Sequence:CCGGTCCTGTAGCAGTGGCAATAAACTCGAGTTTATTGCCACTGCTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177233
FAM19A4 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179288    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177233.4-927s1c1
Sequence:CCGGGCTCAGAAGTTCATAGCCAAACTCGAGTTTGGCTATGAACTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177233.4-672s1c1
Sequence:CCGGGCACAGCCTTCTTGTGTTGAACTCGAGTTCAACACAAGAAGGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177233.4-587s1c1
Sequence:CCGGCTGCTGCAATAAGAACCGCATCTCGAGATGCGGTTCTTATTGCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177233.5-465s1c1
Sequence:CCGGGTTCTGACCTATGTGTTAATGCTCGAGCATTAACACATAGGTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177233.5-1284s21c1
Sequence:CCGGATACGTGTGTTCTAGATTAAACTCGAGTTTAATCTAGAACACACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177233.5-688s21c1
Sequence:CCGGTTGAAGCTGCCATTGTGATTGCTCGAGCAATCACAATGGCAGCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177233.5-465s21c1
Sequence:CCGGGTTCTGACCTATGTGTTAATGCTCGAGCATTAACACATAGGTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177233.5-738s21c1
Sequence:CCGGTTGGAAGGAGAGGACTGTAAACTCGAGTTTACAGTCCTCTCCTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177233.5-783s21c1
Sequence:CCGGTCCTGTAGCAGTGGCAATAAACTCGAGTTTATTGCCACTGCTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177233
FAM19A4 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179288    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177233.4-927s1c1
Sequence:CCGGGCTCAGAAGTTCATAGCCAAACTCGAGTTTGGCTATGAACTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177233.4-672s1c1
Sequence:CCGGGCACAGCCTTCTTGTGTTGAACTCGAGTTCAACACAAGAAGGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177233.4-587s1c1
Sequence:CCGGCTGCTGCAATAAGAACCGCATCTCGAGATGCGGTTCTTATTGCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177233.5-465s1c1
Sequence:CCGGGTTCTGACCTATGTGTTAATGCTCGAGCATTAACACATAGGTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177233.5-1284s21c1
Sequence:CCGGATACGTGTGTTCTAGATTAAACTCGAGTTTAATCTAGAACACACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177233.5-688s21c1
Sequence:CCGGTTGAAGCTGCCATTGTGATTGCTCGAGCAATCACAATGGCAGCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177233.5-465s21c1
Sequence:CCGGGTTCTGACCTATGTGTTAATGCTCGAGCATTAACACATAGGTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177233.5-738s21c1
Sequence:CCGGTTGGAAGGAGAGGACTGTAAACTCGAGTTTACAGTCCTCTCCTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177233.5-783s21c1
Sequence:CCGGTCCTGTAGCAGTGGCAATAAACTCGAGTTTATTGCCACTGCTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005527
FAM19A4 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000128862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005527.1-658s1c1
Sequence:CCGGGATTCAGAAATGGTGGTGTCACTCGAGTGACACCACCATTTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005527.1-1981s1c1
Sequence:CCGGCCCTGTCCTTTCACATTTATACTCGAGTATAAATGTGAAAGGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005527.1-1496s1c1
Sequence:CCGGCCAAAGCTCTATCAGAACATACTCGAGTATGTTCTGATAGAGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005527.1-430s1c1
Sequence:CCGGCGTGTTAATGGTGTGCTGTAACTCGAGTTACAGCACACCATTAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005527.1-1324s1c1
Sequence:CCGGCCTTGAAGAATAGAAGGACATCTCGAGATGTCCTTCTATTCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005527.1-946s21c1
Sequence:CCGGGCCCTCTCTGCTTCGTGATTTCTCGAGAAATCACGAAGCAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005527.1-532s21c1
Sequence:CCGGCGTGCACAGGTGCTGCAATAACTCGAGTTATTGCAGCACCTGTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005527.1-1278s21c1
Sequence:CCGGGCTAGAGATCAACTGATTAACCTCGAGGTTAATCAGTTGATCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005527
FAM19A4 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000128862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005527.1-658s1c1
Sequence:CCGGGATTCAGAAATGGTGGTGTCACTCGAGTGACACCACCATTTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005527.1-1981s1c1
Sequence:CCGGCCCTGTCCTTTCACATTTATACTCGAGTATAAATGTGAAAGGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005527.1-1496s1c1
Sequence:CCGGCCAAAGCTCTATCAGAACATACTCGAGTATGTTCTGATAGAGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005527.1-430s1c1
Sequence:CCGGCGTGTTAATGGTGTGCTGTAACTCGAGTTACAGCACACCATTAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005527.1-1324s1c1
Sequence:CCGGCCTTGAAGAATAGAAGGACATCTCGAGATGTCCTTCTATTCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005527.1-946s21c1
Sequence:CCGGGCCCTCTCTGCTTCGTGATTTCTCGAGAAATCACGAAGCAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005527.1-532s21c1
Sequence:CCGGCGTGCACAGGTGCTGCAATAACTCGAGTTATTGCAGCACCTGTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005527.1-1278s21c1
Sequence:CCGGGCTAGAGATCAACTGATTAACCTCGAGGTTAATCAGTTGATCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005527
FAM19A4 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000128862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005527.1-658s1c1
Sequence:CCGGGATTCAGAAATGGTGGTGTCACTCGAGTGACACCACCATTTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005527.1-1981s1c1
Sequence:CCGGCCCTGTCCTTTCACATTTATACTCGAGTATAAATGTGAAAGGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005527.1-1496s1c1
Sequence:CCGGCCAAAGCTCTATCAGAACATACTCGAGTATGTTCTGATAGAGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005527.1-430s1c1
Sequence:CCGGCGTGTTAATGGTGTGCTGTAACTCGAGTTACAGCACACCATTAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005527.1-1324s1c1
Sequence:CCGGCCTTGAAGAATAGAAGGACATCTCGAGATGTCCTTCTATTCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005527.1-946s21c1
Sequence:CCGGGCCCTCTCTGCTTCGTGATTTCTCGAGAAATCACGAAGCAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005527.1-532s21c1
Sequence:CCGGCGTGCACAGGTGCTGCAATAACTCGAGTTATTGCAGCACCTGTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005527.1-1278s21c1
Sequence:CCGGGCTAGAGATCAACTGATTAACCTCGAGGTTAATCAGTTGATCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks