EMAIL THIS PAGE TO A FRIEND

FAM19A5

family with sequence similarity 19 (chemokine (C-C motif)-like), member A5

108 Gene Product Result for
Synonyms: QLLK5208 TAFA-5 TAFA5 UNQ5208
Gene ID:
Human(25817) Summary: This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines, that act as regulators of immune and nervous cells. [provided by RefSeq, Jul 2008]
Mouse(106014) family with sequence similarity 19, member A5
Rat(500915) family with sequence similarity 19 (chemokine (C-C motif)-like), member A5
Zebrafish(100002919) family with sequence similarity 19 (chemokine (C-C motif)-like), member A5
cow(767927) family with sequence similarity 19 (chemokine (C-C motif)-like), member A5
chicken(768638) family with sequence similarity 19 (chemokine (C-C motif)-like), member A5
sheep(101121083) family with sequence similarity 19 (chemokine (C-C motif)-like), member A5
domestic guinea pig(100723039) family with sequence similarity 19 (chemokine (C-C motif)-like), member A5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1735 Human TAFA5 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134096 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134096 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134096 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015381 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015381 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015381 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU230371 MISSION® esiRNA esiRNA targeting human FAM19A5 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001082967 Rosetta Predictions human pricing
NM_015381 Rosetta Predictions human pricing
XM_001053462 Rosetta Predictions rat pricing
XM_576324 Rosetta Predictions rat pricing
NM_134096 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316772 predicted 365
2 SASI_Hs02_00316773 predicted 402
3 SASI_Hs02_00316774 predicted 632
4 SASI_Hs02_00316775 predicted 622
5 SASI_Hs02_00316776 predicted 332
6 SASI_Hs02_00316777 predicted 244
7 SASI_Hs02_00316778 predicted 978
8 SASI_Hs02_00316779 predicted 932
9 SASI_Hs02_00316780 predicted 244
10 SASI_Hs02_00316781 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196200 predicted 404
2 SASI_Hs01_00196201 predicted 440
3 SASI_Hs01_00196202 predicted 669
4 SASI_Hs01_00196204 predicted 663
5 SASI_Hs01_00196205 predicted 368
6 SASI_Hs01_00196206 predicted 278
7 SASI_Hs01_00196207 predicted 1017
8 SASI_Hs01_00196208 predicted 973
9 SASI_Hs01_00196209 predicted 285
10 SASI_Hs02_00347734 predicted 402
11 SASI_Hs01_00196203 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272410 predicted 1388
2 SASI_Rn02_00272411 predicted 1200
3 SASI_Rn02_00272412 predicted 1380
4 SASI_Rn02_00272413 predicted 1074
5 SASI_Rn02_00272414 predicted 1224
6 SASI_Rn02_00272415 predicted 1157
7 SASI_Rn02_00272416 predicted 1054
8 SASI_Rn02_00272417 predicted 794
9 SASI_Rn02_00272418 predicted 682
10 SASI_Rn02_00272419 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405069 predicted 1390
2 SASI_Rn02_00405070 predicted 1200
3 SASI_Rn02_00405071 predicted 1383
4 SASI_Rn02_00405072 predicted 1071
5 SASI_Rn02_00405073 predicted 1229
6 SASI_Rn02_00405074 predicted 1160
7 SASI_Rn02_00405075 predicted 1060
8 SASI_Rn02_00405076 predicted 799
9 SASI_Rn02_00405077 predicted 682
10 SASI_Rn02_00405078 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164241 predicted 275
2 SASI_Mm01_00164242 predicted 984
3 SASI_Mm01_00164243 predicted 760
4 SASI_Mm01_00164244 predicted 978
5 SASI_Mm01_00164245 predicted 955
6 SASI_Mm02_00339326 predicted 827
7 SASI_Mm01_00164246 predicted 334
8 SASI_Mm01_00164247 predicted 653
9 SASI_Mm01_00164248 predicted 397
10 SASI_Mm01_00164249 predicted 277
11 SASI_Mm01_00164250 predicted 394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134096
FAM19A5 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 19 (chemokine (C-C motif)-like), member A5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134096.2-218s21c1
Sequence:CCGGTTCCTCGTCCTGGTGATTCACCTCGAGGTGAATCACCAGGACGAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134096.2-461s21c1
Sequence:CCGGGAAGGCTGTGACTTGTTAATCCTCGAGGATTAACAAGTCACAGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134096.2-2106s21c1
Sequence:CCGGTGACTATCATGCTAGTAATATCTCGAGATATTACTAGCATGATAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134096.2-1287s1c1
Sequence:CCGGGACCAACTCTATCGTACTAAACTCGAGTTTAGTACGATAGAGTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134096.2-278s21c1
Sequence:CCGGTGTGAGATTGTGACCCTAGACCTCGAGGTCTAGGGTCACAATCTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134096.2-397s21c1
Sequence:CCGGTTGTGTGGACGCTCGAATTATCTCGAGATAATTCGAGCGTCCACACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134096.2-396s1c1
Sequence:CCGGCTTGTGTGGACGCTCGAATTACTCGAGTAATTCGAGCGTCCACACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134096.2-411s1c1
Sequence:CCGGGAATTATCAAGACAAAGCAGTCTCGAGACTGCTTTGTCTTGATAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134096.2-421s1c1
Sequence:CCGGGACAAAGCAGTGGTGTGACATCTCGAGATGTCACACCACTGCTTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134096
FAM19A5 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 19 (chemokine (C-C motif)-like), member A5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134096.2-218s21c1
Sequence:CCGGTTCCTCGTCCTGGTGATTCACCTCGAGGTGAATCACCAGGACGAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134096.2-461s21c1
Sequence:CCGGGAAGGCTGTGACTTGTTAATCCTCGAGGATTAACAAGTCACAGCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134096.2-2106s21c1
Sequence:CCGGTGACTATCATGCTAGTAATATCTCGAGATATTACTAGCATGATAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134096.2-1287s1c1
Sequence:CCGGGACCAACTCTATCGTACTAAACTCGAGTTTAGTACGATAGAGTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134096.2-278s21c1
Sequence:CCGGTGTGAGATTGTGACCCTAGACCTCGAGGTCTAGGGTCACAATCTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134096.2-397s21c1
Sequence:CCGGTTGTGTGGACGCTCGAATTATCTCGAGATAATTCGAGCGTCCACACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134096.2-396s1c1
Sequence:CCGGCTTGTGTGGACGCTCGAATTACTCGAGTAATTCGAGCGTCCACACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134096.2-411s1c1
Sequence:CCGGGAATTATCAAGACAAAGCAGTCTCGAGACTGCTTTGTCTTGATAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134096.2-421s1c1
Sequence:CCGGGACAAAGCAGTGGTGTGACATCTCGAGATGTCACACCACTGCTTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134096
FAM19A5 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 19 (chemokine (C-C motif)-like), member A5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134096.2-218s21c1
Sequence:CCGGTTCCTCGTCCTGGTGATTCACCTCGAGGTGAATCACCAGGACGAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134096.2-461s21c1
Sequence:CCGGGAAGGCTGTGACTTGTTAATCCTCGAGGATTAACAAGTCACAGCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134096.2-2106s21c1
Sequence:CCGGTGACTATCATGCTAGTAATATCTCGAGATATTACTAGCATGATAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134096.2-1287s1c1
Sequence:CCGGGACCAACTCTATCGTACTAAACTCGAGTTTAGTACGATAGAGTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134096.2-278s21c1
Sequence:CCGGTGTGAGATTGTGACCCTAGACCTCGAGGTCTAGGGTCACAATCTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134096.2-397s21c1
Sequence:CCGGTTGTGTGGACGCTCGAATTATCTCGAGATAATTCGAGCGTCCACACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134096.2-396s1c1
Sequence:CCGGCTTGTGTGGACGCTCGAATTACTCGAGTAATTCGAGCGTCCACACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134096.2-411s1c1
Sequence:CCGGGAATTATCAAGACAAAGCAGTCTCGAGACTGCTTTGTCTTGATAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134096.2-421s1c1
Sequence:CCGGGACAAAGCAGTGGTGTGACATCTCGAGATGTCACACCACTGCTTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015381
FAM19A5 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 19 (chemokine (C-C motif)-like), member A5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-172s1c1
Sequence:CCGGCTCAACTTTCTGGGCGTTCATCTCGAGATGAACGCCCAGAAAGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015381.3-1236s1c1
Sequence:CCGGCCTCTGTACTTAGATCAACTTCTCGAGAAGTTGATCTAAGTACAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-373s1c1
Sequence:CCGGCGCAAGAATCATCAAGACCAACTCGAGTTGGTCTTGATGATTCTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-378s1c1
Sequence:CCGGGAATCATCAAGACCAAGCAGTCTCGAGACTGCTTGGTCTTGATGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164056    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015381.3-1226s1c1
Sequence:CCGGCCGCTTTATTCCTCTGTACTTCTCGAGAAGTACAGAGGAATAAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-174s1c1
Sequence:CCGGCAACTTTCTGGGCGTTCATGACTCGAGTCATGAACGCCCAGAAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-428s1c1
Sequence:CCGGGAAGGCTGCGACTTGTTAATCCTCGAGGATTAACAAGTCGCAGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-435s1c1
Sequence:CCGGGCGACTTGTTAATCAACCGGTCTCGAGACCGGTTGATTAACAAGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-368s1c1
Sequence:CCGGGTGGACGCAAGAATCATCAAGCTCGAGCTTGATGATTCTTGCGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-436s1c1
Sequence:CCGGCGACTTGTTAATCAACCGGTCCTCGAGGACCGGTTGATTAACAAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015381
FAM19A5 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 19 (chemokine (C-C motif)-like), member A5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-172s1c1
Sequence:CCGGCTCAACTTTCTGGGCGTTCATCTCGAGATGAACGCCCAGAAAGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015381.3-1236s1c1
Sequence:CCGGCCTCTGTACTTAGATCAACTTCTCGAGAAGTTGATCTAAGTACAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-373s1c1
Sequence:CCGGCGCAAGAATCATCAAGACCAACTCGAGTTGGTCTTGATGATTCTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-378s1c1
Sequence:CCGGGAATCATCAAGACCAAGCAGTCTCGAGACTGCTTGGTCTTGATGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164056    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015381.3-1226s1c1
Sequence:CCGGCCGCTTTATTCCTCTGTACTTCTCGAGAAGTACAGAGGAATAAAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-174s1c1
Sequence:CCGGCAACTTTCTGGGCGTTCATGACTCGAGTCATGAACGCCCAGAAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-428s1c1
Sequence:CCGGGAAGGCTGCGACTTGTTAATCCTCGAGGATTAACAAGTCGCAGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-435s1c1
Sequence:CCGGGCGACTTGTTAATCAACCGGTCTCGAGACCGGTTGATTAACAAGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-368s1c1
Sequence:CCGGGTGGACGCAAGAATCATCAAGCTCGAGCTTGATGATTCTTGCGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-436s1c1
Sequence:CCGGCGACTTGTTAATCAACCGGTCCTCGAGGACCGGTTGATTAACAAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015381
FAM19A5 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 19 (chemokine (C-C motif)-like), member A5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-172s1c1
Sequence:CCGGCTCAACTTTCTGGGCGTTCATCTCGAGATGAACGCCCAGAAAGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015381.3-1236s1c1
Sequence:CCGGCCTCTGTACTTAGATCAACTTCTCGAGAAGTTGATCTAAGTACAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-373s1c1
Sequence:CCGGCGCAAGAATCATCAAGACCAACTCGAGTTGGTCTTGATGATTCTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-378s1c1
Sequence:CCGGGAATCATCAAGACCAAGCAGTCTCGAGACTGCTTGGTCTTGATGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164056    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015381.3-1226s1c1
Sequence:CCGGCCGCTTTATTCCTCTGTACTTCTCGAGAAGTACAGAGGAATAAAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-174s1c1
Sequence:CCGGCAACTTTCTGGGCGTTCATGACTCGAGTCATGAACGCCCAGAAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-428s1c1
Sequence:CCGGGAAGGCTGCGACTTGTTAATCCTCGAGGATTAACAAGTCGCAGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-435s1c1
Sequence:CCGGGCGACTTGTTAATCAACCGGTCTCGAGACCGGTTGATTAACAAGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-368s1c1
Sequence:CCGGGTGGACGCAAGAATCATCAAGCTCGAGCTTGATGATTCTTGCGTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015381.1-436s1c1
Sequence:CCGGCGACTTGTTAATCAACCGGTCCTCGAGGACCGGTTGATTAACAAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)