EMAIL THIS PAGE TO A FRIEND

FAM200A

family with sequence similarity 200, member A

20 Gene Product Result for
Synonyms: C7orf38
Gene ID:
Human(221786) Summary: This gene encodes a protein of unknown function. The protein is weakly similar to transposase-like proteins in human and mouse. [provided by RefSeq, Jul 2008]
cow(101904760) family with sequence similarity 200, member A
dog(100687167) family with sequence similarity 200, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145111 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007781 MISSION® esiRNA esiRNA targeting human C7orf38 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145111 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364975 predicted 340
2 SASI_Hs02_00364976 predicted 334
3 SASI_Hs02_00364977 predicted 394
4 SASI_Hs02_00364978 predicted 391
5 SASI_Hs02_00364979 predicted 344
6 SASI_Hs02_00364980 predicted 346
7 SASI_Hs02_00364981 predicted 382
8 SASI_Hs02_00364982 predicted 350
9 SASI_Hs02_00364983 predicted 342
10 SASI_Hs02_00364984 predicted 341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145111
VALIDATED
FAM200A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 200, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145111.1-848s1c1
Sequence:CCGGGCAACCCACAACAATGCTGTTCTCGAGAACAGCATTGTTGTGGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145111.1-312s1c1
Sequence:CCGGGCTCTACAACTATGAATGAGACTCGAGTCTCATTCATAGTTGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145111.1-786s1c1
Sequence:CCGGCAAGTGATGGAACAGCAAATACTCGAGTATTTGCTGTTCCATCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145111.1-1299s1c1
Sequence:CCGGCGTTATTATTGTGGCAAGCAACTCGAGTTGCTTGCCACAATAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145111.1-738s1c1
Sequence:CCGGGCCTTCTTGGTCAGTATAAATCTCGAGATTTATACTGACCAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145111.2-1929s21c1
Sequence:CCGGTTCAATCTTGACACGGTTAAACTCGAGTTTAACCGTGTCAAGATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145111.2-1554s21c1
Sequence:CCGGCATCGAAGAGAACATTATTAACTCGAGTTAATAATGTTCTCTTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145111.2-1863s21c1
Sequence:CCGGGCTAAGTAGGAAGAGTATATTCTCGAGAATATACTCTTCCTACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145111.2-607s21c1
Sequence:CCGGATGGACATGGTACGGACAATTCTCGAGAATTGTCCGTACCATGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145111
VALIDATED
FAM200A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 200, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145111.1-848s1c1
Sequence:CCGGGCAACCCACAACAATGCTGTTCTCGAGAACAGCATTGTTGTGGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145111.1-312s1c1
Sequence:CCGGGCTCTACAACTATGAATGAGACTCGAGTCTCATTCATAGTTGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145111.1-786s1c1
Sequence:CCGGCAAGTGATGGAACAGCAAATACTCGAGTATTTGCTGTTCCATCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145111.1-1299s1c1
Sequence:CCGGCGTTATTATTGTGGCAAGCAACTCGAGTTGCTTGCCACAATAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145111.1-738s1c1
Sequence:CCGGGCCTTCTTGGTCAGTATAAATCTCGAGATTTATACTGACCAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145111.2-1929s21c1
Sequence:CCGGTTCAATCTTGACACGGTTAAACTCGAGTTTAACCGTGTCAAGATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145111.2-1554s21c1
Sequence:CCGGCATCGAAGAGAACATTATTAACTCGAGTTAATAATGTTCTCTTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145111.2-1863s21c1
Sequence:CCGGGCTAAGTAGGAAGAGTATATTCTCGAGAATATACTCTTCCTACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145111.2-607s21c1
Sequence:CCGGATGGACATGGTACGGACAATTCTCGAGAATTGTCCGTACCATGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145111
VALIDATED
FAM200A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 200, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145111.1-848s1c1
Sequence:CCGGGCAACCCACAACAATGCTGTTCTCGAGAACAGCATTGTTGTGGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145111.1-312s1c1
Sequence:CCGGGCTCTACAACTATGAATGAGACTCGAGTCTCATTCATAGTTGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145111.1-786s1c1
Sequence:CCGGCAAGTGATGGAACAGCAAATACTCGAGTATTTGCTGTTCCATCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145111.1-1299s1c1
Sequence:CCGGCGTTATTATTGTGGCAAGCAACTCGAGTTGCTTGCCACAATAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145111.1-738s1c1
Sequence:CCGGGCCTTCTTGGTCAGTATAAATCTCGAGATTTATACTGACCAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145111.2-1929s21c1
Sequence:CCGGTTCAATCTTGACACGGTTAAACTCGAGTTTAACCGTGTCAAGATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145111.2-1554s21c1
Sequence:CCGGCATCGAAGAGAACATTATTAACTCGAGTTAATAATGTTCTCTTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145111.2-1863s21c1
Sequence:CCGGGCTAAGTAGGAAGAGTATATTCTCGAGAATATACTCTTCCTACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145111.2-607s21c1
Sequence:CCGGATGGACATGGTACGGACAATTCTCGAGAATTGTCCGTACCATGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks