EMAIL THIS PAGE TO A FRIEND

FAM200B

family with sequence similarity 200, member B

32 Gene Product Result for
UniProtKB ID: P0CF97
Gene ID:
domestic cat(101093934) family with sequence similarity 200, member B
cow(100849050) family with sequence similarity 200, member B
sheep(101106431) family with sequence similarity 200, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145191 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017764 Rosetta Predictions human pricing
XR_017908 Rosetta Predictions human pricing
XR_040763 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494382 predicted 209
2 SASI_Hs02_00494383 predicted 207
3 SASI_Hs02_00494384 predicted 4254
4 SASI_Hs02_00494385 predicted 320
5 SASI_Hs02_00494386 predicted 385
6 SASI_Hs02_00494387 predicted 4152
7 SASI_Hs02_00494388 predicted 4203
8 SASI_Hs02_00494389 predicted 348
9 SASI_Hs02_00494390 predicted 223
10 SASI_Hs02_00494391 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494873 predicted 210
2 SASI_Hs02_00494874 predicted 211
3 SASI_Hs02_00494875 predicted 4257
4 SASI_Hs02_00494876 predicted 315
5 SASI_Hs02_00494877 predicted 387
6 SASI_Hs02_00494878 predicted 4150
7 SASI_Hs02_00494879 predicted 4200
8 SASI_Hs02_00494880 predicted 342
9 SASI_Hs02_00494881 predicted 223
10 SASI_Hs02_00494882 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521731 predicted 210
2 SASI_Hs02_00521732 predicted 209
3 SASI_Hs02_00521733 predicted 4260
4 SASI_Hs02_00521734 predicted 317
5 SASI_Hs02_00521735 predicted 387
6 SASI_Hs02_00521736 predicted 4151
7 SASI_Hs02_00521737 predicted 4199
8 SASI_Hs02_00521738 predicted 341
9 SASI_Hs02_00521739 predicted 221
10 SASI_Hs02_00521740 predicted 320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145191
FAM200B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 200, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145191.1-1749s21c1
Sequence:CCGGGCGCATAGTTGGCCAATATAACTCGAGTTATATTGGCCAACTATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145191.1-1711s21c1
Sequence:CCGGCACCTAAGTGGATTAGATATTCTCGAGAATATCTAATCCACTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145191.1-1086s21c1
Sequence:CCGGAGTAAGTGCAAGACGTTATAACTCGAGTTATAACGTCTTGCACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145191.1-1441s21c1
Sequence:CCGGTTGGATATGGTGCGTACAATACTCGAGTATTGTACGCACCATATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145191.1-3264s21c1
Sequence:CCGGAGGGTTCTGTAGACCATTATTCTCGAGAATAATGGTCTACAGAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145191
FAM200B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 200, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145191.1-1749s21c1
Sequence:CCGGGCGCATAGTTGGCCAATATAACTCGAGTTATATTGGCCAACTATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145191.1-1711s21c1
Sequence:CCGGCACCTAAGTGGATTAGATATTCTCGAGAATATCTAATCCACTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145191.1-1086s21c1
Sequence:CCGGAGTAAGTGCAAGACGTTATAACTCGAGTTATAACGTCTTGCACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145191.1-1441s21c1
Sequence:CCGGTTGGATATGGTGCGTACAATACTCGAGTATTGTACGCACCATATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145191.1-3264s21c1
Sequence:CCGGAGGGTTCTGTAGACCATTATTCTCGAGAATAATGGTCTACAGAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145191
FAM200B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 200, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145191.1-1749s21c1
Sequence:CCGGGCGCATAGTTGGCCAATATAACTCGAGTTATATTGGCCAACTATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145191.1-1711s21c1
Sequence:CCGGCACCTAAGTGGATTAGATATTCTCGAGAATATCTAATCCACTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145191.1-1086s21c1
Sequence:CCGGAGTAAGTGCAAGACGTTATAACTCGAGTTATAACGTCTTGCACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145191.1-1441s21c1
Sequence:CCGGTTGGATATGGTGCGTACAATACTCGAGTATTGTACGCACCATATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145191.1-3264s21c1
Sequence:CCGGAGGGTTCTGTAGACCATTATTCTCGAGAATAATGGTCTACAGAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks