EMAIL THIS PAGE TO A FRIEND

FAM203A

family with sequence similarity 203, member A

Synonyms: BRP16 C8orf30A
UniProtKB ID: Q9BTY7
Gene ID:
Mouse(59053) family with sequence similarity 203, member A
Rat(315094) family with sequence similarity 203, member A
Zebrafish(436795) family with sequence similarity 203, member A
domestic cat(101094733) family with sequence similarity 203, member A
cow(509113) family with sequence similarity 203, member A
domestic guinea pig(100733008) family with sequence similarity 203, member A
naked mole-rat(101726569) family with sequence similarity 203, member A
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016458 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021555 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021555 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021555 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016458 Rosetta Predictions human pricing
NM_001007707 Rosetta Predictions rat pricing
NM_021555 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235136 predicted 908
2 SASI_Hs01_00235137 predicted 990
3 SASI_Hs01_00235138 predicted 1357
4 SASI_Hs01_00235139 predicted 1367
5 SASI_Hs01_00235140 predicted 1368
6 SASI_Hs01_00235141 predicted 1055
7 SASI_Hs01_00235142 predicted 1086
8 SASI_Hs01_00235143 predicted 743
9 SASI_Hs01_00235145 predicted 542
10 SASI_Hs02_00349497 predicted 1380
11 SASI_Hs01_00235144 predicted 1656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044918 predicted 1301
2 SASI_Rn01_00044919 predicted 1312
3 SASI_Rn01_00044920 predicted 1019
4 SASI_Rn01_00044921 predicted 1159
5 SASI_Rn01_00044922 predicted 705
6 SASI_Rn01_00044924 predicted 767
7 SASI_Rn01_00044925 predicted 1566
8 SASI_Rn01_00044926 predicted 703
9 SASI_Rn01_00044927 predicted 1491
10 SASI_Rn02_00198880 predicted 1080
11 SASI_Rn01_00044923 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021555 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326325 predicted 1288
2 SASI_Mm02_00326326 predicted 1486
3 SASI_Mm02_00326327 predicted 339
4 SASI_Mm02_00326328 predicted 1363
5 SASI_Mm02_00326329 predicted 1711
6 SASI_Mm02_00326330 predicted 688
7 SASI_Mm02_00326331 predicted 1356
8 SASI_Mm02_00326332 predicted 1482
9 SASI_Mm02_00326333 predicted 1267
10 SASI_Mm02_00326334 predicted 1001
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016458
FAM203A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 203, member A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016458.2-1359s21c1
Sequence:CCGGGAGAAGCAGAGCTACGCTTAGCTCGAGCTAAGCGTAGCTCTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016458.2-1065s21c1
Sequence:CCGGAGCTCATCCAGGTGCTTATTGCTCGAGCAATAAGCACCTGGATGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016458.2-920s21c1
Sequence:CCGGATCCGCAAGATGCTTGTTGAACTCGAGTTCAACAAGCATCTTGCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016458.2-1419s21c1
Sequence:CCGGGTGTTGCTACCAGCAAGAATGCTCGAGCATTCTTGCTGGTAGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166536    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016458.2-1384s1c1
Sequence:CCGGCAGTAAGGATTGGAGGCACTTCTCGAGAAGTGCCTCCAATCCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165756    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016458.2-1836s1c1
Sequence:CCGGCCTGTTTCCCAGTCTCAGATTCTCGAGAATCTGAGACTGGGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166057    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016458.2-1649s1c1
Sequence:CCGGGCATAGGTACAAGTGCTGCTTCTCGAGAAGCAGCACTTGTACCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165577    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016458.2-2255s1c1
Sequence:CCGGGCTTAGCTTGTCTTCTTGGCACTCGAGTGCCAAGAAGACAAGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016458.2-1822s1c1
Sequence:CCGGGCTCCCTAAGTCTTCCTGTTTCTCGAGAAACAGGAAGACTTAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016458.2-931s1c1
Sequence:CCGGGCTTGTTGAAGCCATCATGCTCTCGAGAGCATGATGGCTTCAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016458.2-924s1c1
Sequence:CCGGGCAAGATGCTTGTTGAAGCCACTCGAGTGGCTTCAACAAGCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016458.2-1063s1c1
Sequence:CCGGGAAGCTCATCCAGGTGCTTATCTCGAGATAAGCACCTGGATGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016458
FAM203A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 203, member A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016458.2-1359s21c1
Sequence:CCGGGAGAAGCAGAGCTACGCTTAGCTCGAGCTAAGCGTAGCTCTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016458.2-1065s21c1
Sequence:CCGGAGCTCATCCAGGTGCTTATTGCTCGAGCAATAAGCACCTGGATGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016458.2-920s21c1
Sequence:CCGGATCCGCAAGATGCTTGTTGAACTCGAGTTCAACAAGCATCTTGCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016458.2-1419s21c1
Sequence:CCGGGTGTTGCTACCAGCAAGAATGCTCGAGCATTCTTGCTGGTAGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166536    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016458.2-1384s1c1
Sequence:CCGGCAGTAAGGATTGGAGGCACTTCTCGAGAAGTGCCTCCAATCCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165756    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016458.2-1836s1c1
Sequence:CCGGCCTGTTTCCCAGTCTCAGATTCTCGAGAATCTGAGACTGGGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166057    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016458.2-1649s1c1
Sequence:CCGGGCATAGGTACAAGTGCTGCTTCTCGAGAAGCAGCACTTGTACCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165577    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016458.2-2255s1c1
Sequence:CCGGGCTTAGCTTGTCTTCTTGGCACTCGAGTGCCAAGAAGACAAGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016458.2-1822s1c1
Sequence:CCGGGCTCCCTAAGTCTTCCTGTTTCTCGAGAAACAGGAAGACTTAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016458.2-931s1c1
Sequence:CCGGGCTTGTTGAAGCCATCATGCTCTCGAGAGCATGATGGCTTCAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016458.2-924s1c1
Sequence:CCGGGCAAGATGCTTGTTGAAGCCACTCGAGTGGCTTCAACAAGCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016458.2-1063s1c1
Sequence:CCGGGAAGCTCATCCAGGTGCTTATCTCGAGATAAGCACCTGGATGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016458
FAM203A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 203, member A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016458.2-1359s21c1
Sequence:CCGGGAGAAGCAGAGCTACGCTTAGCTCGAGCTAAGCGTAGCTCTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016458.2-1065s21c1
Sequence:CCGGAGCTCATCCAGGTGCTTATTGCTCGAGCAATAAGCACCTGGATGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016458.2-920s21c1
Sequence:CCGGATCCGCAAGATGCTTGTTGAACTCGAGTTCAACAAGCATCTTGCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016458.2-1419s21c1
Sequence:CCGGGTGTTGCTACCAGCAAGAATGCTCGAGCATTCTTGCTGGTAGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166536    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016458.2-1384s1c1
Sequence:CCGGCAGTAAGGATTGGAGGCACTTCTCGAGAAGTGCCTCCAATCCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165756    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016458.2-1836s1c1
Sequence:CCGGCCTGTTTCCCAGTCTCAGATTCTCGAGAATCTGAGACTGGGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166057    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016458.2-1649s1c1
Sequence:CCGGGCATAGGTACAAGTGCTGCTTCTCGAGAAGCAGCACTTGTACCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165577    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016458.2-2255s1c1
Sequence:CCGGGCTTAGCTTGTCTTCTTGGCACTCGAGTGCCAAGAAGACAAGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016458.2-1822s1c1
Sequence:CCGGGCTCCCTAAGTCTTCCTGTTTCTCGAGAAACAGGAAGACTTAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016458.2-931s1c1
Sequence:CCGGGCTTGTTGAAGCCATCATGCTCTCGAGAGCATGATGGCTTCAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016458.2-924s1c1
Sequence:CCGGGCAAGATGCTTGTTGAAGCCACTCGAGTGGCTTCAACAAGCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016458.2-1063s1c1
Sequence:CCGGGAAGCTCATCCAGGTGCTTATCTCGAGATAAGCACCTGGATGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021555
VALIDATED
FAM203A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 203, member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021555.1-1142s21c1
Sequence:CCGGGTACCTGAAGACGTGGAACAACTCGAGTTGTTCCACGTCTTCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021555.1-1824s21c1
Sequence:CCGGGCTAGATAGAACCTGCTCCTTCTCGAGAAGGAGCAGGTTCTATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021555.1-769s21c1
Sequence:CCGGGCATCGACATCACAAGTGGTTCTCGAGAACCACTTGTGATGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021555.1-889s21c1
Sequence:CCGGGCAGTACTTGTCACCAGACAACTCGAGTTGTCTGGTGACAAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021555.1-769s1c1
Sequence:CCGGGCATCGACATCACAAGTGGTTCTCGAGAACCACTTGTGATGTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021555.1-1824s1c1
Sequence:CCGGGCTAGATAGAACCTGCTCCTTCTCGAGAAGGAGCAGGTTCTATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021555.1-889s1c1
Sequence:CCGGGCAGTACTTGTCACCAGACAACTCGAGTTGTCTGGTGACAAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021555.1-1142s1c1
Sequence:CCGGGTACCTGAAGACGTGGAACAACTCGAGTTGTTCCACGTCTTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021555
VALIDATED
FAM203A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 203, member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021555.1-1142s21c1
Sequence:CCGGGTACCTGAAGACGTGGAACAACTCGAGTTGTTCCACGTCTTCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021555.1-1824s21c1
Sequence:CCGGGCTAGATAGAACCTGCTCCTTCTCGAGAAGGAGCAGGTTCTATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021555.1-769s21c1
Sequence:CCGGGCATCGACATCACAAGTGGTTCTCGAGAACCACTTGTGATGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021555.1-889s21c1
Sequence:CCGGGCAGTACTTGTCACCAGACAACTCGAGTTGTCTGGTGACAAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021555.1-769s1c1
Sequence:CCGGGCATCGACATCACAAGTGGTTCTCGAGAACCACTTGTGATGTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021555.1-1824s1c1
Sequence:CCGGGCTAGATAGAACCTGCTCCTTCTCGAGAAGGAGCAGGTTCTATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021555.1-889s1c1
Sequence:CCGGGCAGTACTTGTCACCAGACAACTCGAGTTGTCTGGTGACAAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021555.1-1142s1c1
Sequence:CCGGGTACCTGAAGACGTGGAACAACTCGAGTTGTTCCACGTCTTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021555
VALIDATED
FAM203A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 203, member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021555.1-1142s21c1
Sequence:CCGGGTACCTGAAGACGTGGAACAACTCGAGTTGTTCCACGTCTTCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021555.1-1824s21c1
Sequence:CCGGGCTAGATAGAACCTGCTCCTTCTCGAGAAGGAGCAGGTTCTATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021555.1-769s21c1
Sequence:CCGGGCATCGACATCACAAGTGGTTCTCGAGAACCACTTGTGATGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021555.1-889s21c1
Sequence:CCGGGCAGTACTTGTCACCAGACAACTCGAGTTGTCTGGTGACAAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021555.1-769s1c1
Sequence:CCGGGCATCGACATCACAAGTGGTTCTCGAGAACCACTTGTGATGTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021555.1-1824s1c1
Sequence:CCGGGCTAGATAGAACCTGCTCCTTCTCGAGAAGGAGCAGGTTCTATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021555.1-889s1c1
Sequence:CCGGGCAGTACTTGTCACCAGACAACTCGAGTTGTCTGGTGACAAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021555.1-1142s1c1
Sequence:CCGGGTACCTGAAGACGTGGAACAACTCGAGTTGTTCCACGTCTTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks