EMAIL THIS PAGE TO A FRIEND

FAM204A

family with sequence similarity 204, member A

66 Gene Product Result for
Synonyms: C10orf84 bA319I23.1
UniProtKB ID: Q9H8W3, D3DRC6, Q5T373, Q9H5V5
Gene ID:
Rat(308004) family with sequence similarity 204, member A
Zebrafish(436809) family with sequence similarity 204, member A
chicken(423925) family with sequence similarity 204, member A
dog(477835) family with sequence similarity 204, member A
cow(507725) family with sequence similarity 204, member A
domestic cat(101087271) family with sequence similarity 204, member A
naked mole-rat(101723055) family with sequence similarity 204, member A
domestic guinea pig(100718274) family with sequence similarity 204, member A
sheep(101105706) family with sequence similarity 204, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022063 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107451 MISSION® esiRNA esiRNA human C10orf84 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022063 Rosetta Predictions human pricing
NM_001107448 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192154 predicted 322
2 SASI_Hs01_00192155 predicted 525
3 SASI_Hs01_00192156 predicted 658
4 SASI_Hs01_00192157 predicted 404
5 SASI_Hs01_00192158 predicted 754
6 SASI_Hs01_00192159 predicted 925
7 SASI_Hs01_00192160 predicted 592
8 SASI_Hs01_00192162 predicted 781
9 SASI_Hs01_00192163 predicted 288
10 SASI_Hs02_00355429 predicted 420
11 SASI_Hs01_00192161 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228925 predicted 1665
2 SASI_Rn02_00228926 predicted 1373
3 SASI_Rn02_00228927 predicted 1161
4 SASI_Rn02_00228928 predicted 1261
5 SASI_Rn02_00228929 predicted 1261
6 SASI_Rn02_00228930 predicted 467
7 SASI_Rn02_00228931 predicted 1255
8 SASI_Rn02_00228932 predicted 1618
9 SASI_Rn02_00228933 predicted 478
10 SASI_Rn02_00228934 predicted 1156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022063
VALIDATED
FAM204A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 204, member A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022063.1-741s1c1
Sequence:CCGGGAATATTGAGAAGGCTGAGGACTCGAGTCCTCAGCCTTCTCAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022063.1-658s1c1
Sequence:CCGGGATAGATTTGACCCGCCTGTTCTCGAGAACAGGCGGGTCAAATCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022063.1-289s1c1
Sequence:CCGGGCTGAGTCAAACTCGGAAGATCTCGAGATCTTCCGAGTTTGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022063.1-296s1c1
Sequence:CCGGCAAACTCGGAAGATGAAGCTACTCGAGTAGCTTCATCTTCCGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022063.1-901s1c1
Sequence:CCGGGAAGCAAAGAAGAGATGGGAACTCGAGTTCCCATCTCTTCTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022063.1-273s1c1
Sequence:CCGGCCTAAATGAAAGTGACGCTGACTCGAGTCAGCGTCACTTTCATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022063.2-1262s21c1
Sequence:CCGGTTTGGCGCTTTCCATTCATTTCTCGAGAAATGAATGGAAAGCGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022063.2-445s21c1
Sequence:CCGGTCAAATGTAAATGCCTATGAACTCGAGTTCATAGGCATTTACATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022063.2-339s21c1
Sequence:CCGGGTTGGAGAACTCTGGACTTAACTCGAGTTAAGTCCAGAGTTCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022063.2-996s21c1
Sequence:CCGGTAGACTCAAATGCTCAATTTACTCGAGTAAATTGAGCATTTGAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022063.2-484s21c1
Sequence:CCGGCCCATAGATATGTGGAATAAACTCGAGTTTATTCCACATATCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022063.2-618s21c1
Sequence:CCGGTAGTGAACCGTCCTCAAATGACTCGAGTCATTTGAGGACGGTTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022063
VALIDATED
FAM204A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 204, member A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022063.1-741s1c1
Sequence:CCGGGAATATTGAGAAGGCTGAGGACTCGAGTCCTCAGCCTTCTCAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022063.1-658s1c1
Sequence:CCGGGATAGATTTGACCCGCCTGTTCTCGAGAACAGGCGGGTCAAATCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022063.1-289s1c1
Sequence:CCGGGCTGAGTCAAACTCGGAAGATCTCGAGATCTTCCGAGTTTGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022063.1-296s1c1
Sequence:CCGGCAAACTCGGAAGATGAAGCTACTCGAGTAGCTTCATCTTCCGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022063.1-901s1c1
Sequence:CCGGGAAGCAAAGAAGAGATGGGAACTCGAGTTCCCATCTCTTCTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022063.1-273s1c1
Sequence:CCGGCCTAAATGAAAGTGACGCTGACTCGAGTCAGCGTCACTTTCATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022063.2-1262s21c1
Sequence:CCGGTTTGGCGCTTTCCATTCATTTCTCGAGAAATGAATGGAAAGCGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022063.2-445s21c1
Sequence:CCGGTCAAATGTAAATGCCTATGAACTCGAGTTCATAGGCATTTACATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022063.2-339s21c1
Sequence:CCGGGTTGGAGAACTCTGGACTTAACTCGAGTTAAGTCCAGAGTTCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022063.2-996s21c1
Sequence:CCGGTAGACTCAAATGCTCAATTTACTCGAGTAAATTGAGCATTTGAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022063.2-484s21c1
Sequence:CCGGCCCATAGATATGTGGAATAAACTCGAGTTTATTCCACATATCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022063.2-618s21c1
Sequence:CCGGTAGTGAACCGTCCTCAAATGACTCGAGTCATTTGAGGACGGTTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022063
VALIDATED
FAM204A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 204, member A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022063.1-741s1c1
Sequence:CCGGGAATATTGAGAAGGCTGAGGACTCGAGTCCTCAGCCTTCTCAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022063.1-658s1c1
Sequence:CCGGGATAGATTTGACCCGCCTGTTCTCGAGAACAGGCGGGTCAAATCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022063.1-289s1c1
Sequence:CCGGGCTGAGTCAAACTCGGAAGATCTCGAGATCTTCCGAGTTTGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022063.1-296s1c1
Sequence:CCGGCAAACTCGGAAGATGAAGCTACTCGAGTAGCTTCATCTTCCGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022063.1-901s1c1
Sequence:CCGGGAAGCAAAGAAGAGATGGGAACTCGAGTTCCCATCTCTTCTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022063.1-273s1c1
Sequence:CCGGCCTAAATGAAAGTGACGCTGACTCGAGTCAGCGTCACTTTCATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022063.2-1262s21c1
Sequence:CCGGTTTGGCGCTTTCCATTCATTTCTCGAGAAATGAATGGAAAGCGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022063.2-445s21c1
Sequence:CCGGTCAAATGTAAATGCCTATGAACTCGAGTTCATAGGCATTTACATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022063.2-339s21c1
Sequence:CCGGGTTGGAGAACTCTGGACTTAACTCGAGTTAAGTCCAGAGTTCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022063.2-996s21c1
Sequence:CCGGTAGACTCAAATGCTCAATTTACTCGAGTAAATTGAGCATTTGAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022063.2-484s21c1
Sequence:CCGGCCCATAGATATGTGGAATAAACTCGAGTTTATTCCACATATCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022063.2-618s21c1
Sequence:CCGGTAGTGAACCGTCCTCAAATGACTCGAGTCATTTGAGGACGGTTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks