EMAIL THIS PAGE TO A FRIEND

FAM205A

family with sequence similarity 205, member A

32 Gene Product Result for
Synonyms: C9orf144B
UniProtKB ID: Q6ZU69, A8MVW7
Gene ID:
Rat(100361292) family with sequence similarity 205, member A
dog(100688710) family with sequence similarity 205, member A
cow(783971) family with sequence similarity 205, member A
domestic guinea pig(100725845) family with sequence similarity 205, member A
naked mole-rat(101710867) family with sequence similarity 205, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001141917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001141917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001141917 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_041842 Rosetta Predictions human pricing
XR_041843 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530823 predicted 443
2 SASI_Hs02_00530824 predicted 298
3 SASI_Hs02_00530825 predicted 306
4 SASI_Hs02_00530826 predicted 217
5 SASI_Hs02_00530827 predicted 264
6 SASI_Hs02_00530828 predicted 164
7 SASI_Hs02_00530829 predicted 20
8 SASI_Hs02_00530830 predicted 171
9 SASI_Hs02_00530831 predicted 50
10 SASI_Hs02_00530832 predicted 4069
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530833 predicted 439
2 SASI_Hs02_00530834 predicted 294
3 SASI_Hs02_00530835 predicted 308
4 SASI_Hs02_00530836 predicted 220
5 SASI_Hs02_00530837 predicted 268
6 SASI_Hs02_00530838 predicted 163
7 SASI_Hs02_00530839 predicted 12
8 SASI_Hs02_00530840 predicted 168
9 SASI_Hs02_00530841 predicted 53
10 SASI_Hs02_00530842 predicted 4071
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001141917
FAM205A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 205, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141917.1-166s21c1
Sequence:CCGGGGCTCCATCTTCATCGTTATTCTCGAGAATAACGATGAAGATGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141917.1-1076s21c1
Sequence:CCGGTGCCAAACCCACCATTGTATTCTCGAGAATACAATGGTGGGTTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141917.1-681s21c1
Sequence:CCGGTGCAGATGGCATACAAGATTACTCGAGTAATCTTGTATGCCATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141917.1-532s21c1
Sequence:CCGGATGCTGTCTACGTCTAGTATGCTCGAGCATACTAGACGTAGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001141917.1-4126s21c1
Sequence:CCGGACCCTCACCTCAGATAGAAACCTCGAGGTTTCTATCTGAGGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001141917
FAM205A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 205, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141917.1-166s21c1
Sequence:CCGGGGCTCCATCTTCATCGTTATTCTCGAGAATAACGATGAAGATGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141917.1-1076s21c1
Sequence:CCGGTGCCAAACCCACCATTGTATTCTCGAGAATACAATGGTGGGTTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141917.1-681s21c1
Sequence:CCGGTGCAGATGGCATACAAGATTACTCGAGTAATCTTGTATGCCATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141917.1-532s21c1
Sequence:CCGGATGCTGTCTACGTCTAGTATGCTCGAGCATACTAGACGTAGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001141917.1-4126s21c1
Sequence:CCGGACCCTCACCTCAGATAGAAACCTCGAGGTTTCTATCTGAGGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001141917
FAM205A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 205, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141917.1-166s21c1
Sequence:CCGGGGCTCCATCTTCATCGTTATTCTCGAGAATAACGATGAAGATGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141917.1-1076s21c1
Sequence:CCGGTGCCAAACCCACCATTGTATTCTCGAGAATACAATGGTGGGTTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141917.1-681s21c1
Sequence:CCGGTGCAGATGGCATACAAGATTACTCGAGTAATCTTGTATGCCATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141917.1-532s21c1
Sequence:CCGGATGCTGTCTACGTCTAGTATGCTCGAGCATACTAGACGTAGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001141917.1-4126s21c1
Sequence:CCGGACCCTCACCTCAGATAGAAACCTCGAGGTTTCTATCTGAGGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks