EMAIL THIS PAGE TO A FRIEND

FAM206A

family with sequence similarity 206, member A

44 Gene Product Result for
Synonyms: C9orf6 CG-8
UniProtKB ID: Q9NX38, Q5JTR0, Q5JTR1
Gene ID:
Rat(298018) family with sequence similarity 206, member A
Zebrafish(560419) family with sequence similarity 206, member A
cow(507081) family with sequence similarity 206, member A
domestic cat(101087360) family with sequence similarity 206, member A
chicken(420983) family with sequence similarity 206, member A
naked mole-rat(101722769) family with sequence similarity 206, member A
domestic guinea pig(100736175) family with sequence similarity 206, member A
sheep(101115428) family with sequence similarity 206, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017832 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104441 MISSION® esiRNA esiRNA human C9orf6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017832 Rosetta Predictions human pricing
XR_006264 Rosetta Predictions rat pricing
XR_007760 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035626 predicted 410
2 SASI_Hs01_00035627 predicted 536
3 SASI_Hs01_00035628 predicted 607
4 SASI_Hs01_00035629 predicted 711
5 SASI_Hs01_00035630 predicted 504
6 SASI_Hs01_00035631 predicted 654
7 SASI_Hs01_00035633 predicted 366
8 SASI_Hs01_00035634 predicted 619
9 SASI_Hs01_00035635 predicted 434
10 SASI_Hs02_00350713 predicted 368
11 SASI_Hs01_00035632 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006264 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00155454 predicted 439
2 SASI_Rn01_00155455 predicted 434
3 SASI_Rn02_00411554 predicted 464
4 SASI_Rn01_00155456 predicted 537
5 SASI_Rn01_00155457 predicted 465
6 SASI_Rn01_00155458 predicted 460
7 SASI_Rn01_00155459 predicted 470
8 SASI_Rn01_00155460 predicted 516
9 SASI_Rn01_00155461 predicted 522
10 SASI_Rn01_00155462 predicted 436
11 SASI_Rn01_00155463 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00143057 predicted 444
2 SASI_Rn01_00143058 predicted 435
3 SASI_Rn02_00415406 predicted 465
4 SASI_Rn01_00143059 predicted 537
5 SASI_Rn01_00143060 predicted 470
6 SASI_Rn01_00143061 predicted 463
7 SASI_Rn01_00143062 predicted 478
8 SASI_Rn01_00143063 predicted 514
9 SASI_Rn01_00143064 predicted 524
10 SASI_Rn01_00143065 predicted 435
11 SASI_Rn01_00143066 predicted 451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017832
VALIDATED
FAM206A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 206, member A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017832.3-359s21c1
Sequence:CCGGGCACAGTTTCTAACAGAGCTTCTCGAGAAGCTCTGTTAGAAACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017832.3-429s21c1
Sequence:CCGGCTAGTTGTGTTAGAGGACGTTCTCGAGAACGTCCTCTAACACAACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017832.3-210s21c1
Sequence:CCGGTACAGCACTCTAACCGAATATCTCGAGATATTCGGTTAGAGTGCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017832.3-288s21c1
Sequence:CCGGGCATTTCCTATCAGATCAGTACTCGAGTACTGATCTGATAGGAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017832.3-986s21c1
Sequence:CCGGTTTACCCATCATCCCATAATCCTCGAGGATTATGGGATGATGGGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017832.2-808s1c1
Sequence:CCGGGAAGTCATGGTGAAACGCATTCTCGAGAATGCGTTTCACCATGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017832.2-641s1c1
Sequence:CCGGCTAGTTGTGTTAGAGGACGTTCTCGAGAACGTCCTCTAACACAACTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017832.2-571s1c1
Sequence:CCGGGCACAGTTTCTAACAGAGCTTCTCGAGAAGCTCTGTTAGAAACTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017832.2-540s1c1
Sequence:CCGGGAACAAGGTCTCTGGGAAATTCTCGAGAATTTCCCAGAGACCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017832.2-522s1c1
Sequence:CCGGCAACTGTAGCAGACTTCAGAACTCGAGTTCTGAAGTCTGCTACAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017832.2-500s1c1
Sequence:CCGGGCATTTCCTATCAGATCAGTACTCGAGTACTGATCTGATAGGAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017832.2-435s1c1
Sequence:CCGGCCGAATATGTGTCATCACATTCTCGAGAATGTGATGACACATATTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017832.2-1827s1c1
Sequence:CCGGCGGGAAGCTAATTCTTGAAATCTCGAGATTTCAAGAATTAGCTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017832
VALIDATED
FAM206A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 206, member A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017832.3-359s21c1
Sequence:CCGGGCACAGTTTCTAACAGAGCTTCTCGAGAAGCTCTGTTAGAAACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017832.3-429s21c1
Sequence:CCGGCTAGTTGTGTTAGAGGACGTTCTCGAGAACGTCCTCTAACACAACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017832.3-210s21c1
Sequence:CCGGTACAGCACTCTAACCGAATATCTCGAGATATTCGGTTAGAGTGCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017832.3-288s21c1
Sequence:CCGGGCATTTCCTATCAGATCAGTACTCGAGTACTGATCTGATAGGAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017832.3-986s21c1
Sequence:CCGGTTTACCCATCATCCCATAATCCTCGAGGATTATGGGATGATGGGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017832.2-808s1c1
Sequence:CCGGGAAGTCATGGTGAAACGCATTCTCGAGAATGCGTTTCACCATGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017832.2-641s1c1
Sequence:CCGGCTAGTTGTGTTAGAGGACGTTCTCGAGAACGTCCTCTAACACAACTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017832.2-571s1c1
Sequence:CCGGGCACAGTTTCTAACAGAGCTTCTCGAGAAGCTCTGTTAGAAACTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017832.2-540s1c1
Sequence:CCGGGAACAAGGTCTCTGGGAAATTCTCGAGAATTTCCCAGAGACCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017832.2-522s1c1
Sequence:CCGGCAACTGTAGCAGACTTCAGAACTCGAGTTCTGAAGTCTGCTACAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017832.2-500s1c1
Sequence:CCGGGCATTTCCTATCAGATCAGTACTCGAGTACTGATCTGATAGGAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017832.2-435s1c1
Sequence:CCGGCCGAATATGTGTCATCACATTCTCGAGAATGTGATGACACATATTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017832.2-1827s1c1
Sequence:CCGGCGGGAAGCTAATTCTTGAAATCTCGAGATTTCAAGAATTAGCTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017832
VALIDATED
FAM206A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 206, member A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017832.3-359s21c1
Sequence:CCGGGCACAGTTTCTAACAGAGCTTCTCGAGAAGCTCTGTTAGAAACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017832.3-429s21c1
Sequence:CCGGCTAGTTGTGTTAGAGGACGTTCTCGAGAACGTCCTCTAACACAACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017832.3-210s21c1
Sequence:CCGGTACAGCACTCTAACCGAATATCTCGAGATATTCGGTTAGAGTGCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017832.3-288s21c1
Sequence:CCGGGCATTTCCTATCAGATCAGTACTCGAGTACTGATCTGATAGGAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017832.3-986s21c1
Sequence:CCGGTTTACCCATCATCCCATAATCCTCGAGGATTATGGGATGATGGGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017832.2-808s1c1
Sequence:CCGGGAAGTCATGGTGAAACGCATTCTCGAGAATGCGTTTCACCATGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017832.2-641s1c1
Sequence:CCGGCTAGTTGTGTTAGAGGACGTTCTCGAGAACGTCCTCTAACACAACTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017832.2-571s1c1
Sequence:CCGGGCACAGTTTCTAACAGAGCTTCTCGAGAAGCTCTGTTAGAAACTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017832.2-540s1c1
Sequence:CCGGGAACAAGGTCTCTGGGAAATTCTCGAGAATTTCCCAGAGACCTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017832.2-522s1c1
Sequence:CCGGCAACTGTAGCAGACTTCAGAACTCGAGTTCTGAAGTCTGCTACAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017832.2-500s1c1
Sequence:CCGGGCATTTCCTATCAGATCAGTACTCGAGTACTGATCTGATAGGAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017832.2-435s1c1
Sequence:CCGGCCGAATATGTGTCATCACATTCTCGAGAATGTGATGACACATATTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017832.2-1827s1c1
Sequence:CCGGCGGGAAGCTAATTCTTGAAATCTCGAGATTTCAAGAATTAGCTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)