EMAIL THIS PAGE TO A FRIEND

FAM208A

family with sequence similarity 208, member A

Synonyms: C3orf63 RAP140 se89-1
UniProtKB ID: Q9UK61, A1L3A4, B5ME28, Q9H2F7, Q9UPP7
Gene ID:
Rat(680155) family with sequence similarity 208, member A
chicken(415999) family with sequence similarity 208, member A
cow(510095) family with sequence similarity 208, member A
domestic cat(101095405) family with sequence similarity 208, member A
dog(476580) family with sequence similarity 208, member A
naked mole-rat(101706714) family with sequence similarity 208, member A
domestic guinea pig(100722228) family with sequence similarity 208, member A
sheep(101104275) family with sequence similarity 208, member A
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015224 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092911 MISSION® esiRNA esiRNA human C3orf63 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001112736 Rosetta Predictions human pricing
NM_015224 Rosetta Predictions human pricing
XM_001055921 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325515 predicted 4317
2 SASI_Hs02_00325516 predicted 2646
3 SASI_Hs02_00325517 predicted 1340
4 SASI_Hs02_00325518 predicted 1879
5 SASI_Hs02_00325519 predicted 3403
6 SASI_Hs02_00325520 predicted 1591
7 SASI_Hs02_00325521 predicted 3388
8 SASI_Hs02_00325522 predicted 2638
9 SASI_Hs02_00325523 predicted 2565
10 SASI_Hs02_00325524 predicted 4187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347330 predicted 3538
2 SASI_Hs02_00347331 predicted 2004
3 SASI_Hs02_00347332 predicted 691
4 SASI_Hs01_00218440 predicted 1232
5 SASI_Hs01_00218441 predicted 2635
6 SASI_Hs01_00218442 predicted 936
7 SASI_Hs01_00218443 predicted 2613
8 SASI_Hs01_00218445 predicted 1994
9 SASI_Hs01_00218446 predicted 1918
10 SASI_Hs01_00218448 predicted 3416
11 SASI_Hs01_00218439 predicted 4072
12 SASI_Hs01_00218444 predicted 2484
13 SASI_Hs01_00218447 predicted 3958
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055921 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281439 predicted 421
2 SASI_Rn02_00281440 predicted 362
3 SASI_Rn02_00281441 predicted 395
4 SASI_Rn02_00281442 predicted 359
5 SASI_Rn02_00281443 predicted 269
6 SASI_Rn02_00281444 predicted 412
7 SASI_Rn02_00281445 predicted 417
8 SASI_Rn02_00281446 predicted 389
9 SASI_Rn02_00281447 predicted 393
10 SASI_Rn02_00281448 predicted 841
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015224
FAM208A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 208, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015224.3-4141s21c1
Sequence:CCGGGTCCCATCAGTTTAGTCATTTCTCGAGAAATGACTAAACTGATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015224.3-4114s21c1
Sequence:CCGGTCAGGTTTATCATAGTCAATTCTCGAGAATTGACTATGATAAACCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015224.3-2778s21c1
Sequence:CCGGAGCATTCCACTTCGGCTTTAACTCGAGTTAAAGCCGAAGTGGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015224.1-2410s1c1
Sequence:CCGGGTTCCCATTGAACATGGATTTCTCGAGAAATCCATGTTCAATGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167641    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015224.1-6128s1c1
Sequence:CCGGGCCCTGAAATCACATTGATATCTCGAGATATCAATGTGATTTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167047    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015224.1-5747s1c1
Sequence:CCGGCGCCAGACTATATTAAGGTAACTCGAGTTACCTTAATATAGTCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015224.1-3703s1c1
Sequence:CCGGCAATGGAAAGTCCACTGTAAACTCGAGTTTACAGTGGACTTTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015224.1-3466s1c1
Sequence:CCGGGCAGGTTTCATTCACAAGATACTCGAGTATCTTGTGAATGAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166998    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015224.1-4364s1c1
Sequence:CCGGGCAATTCAACAGAACAAGATTCTCGAGAATCTTGTTCTGTTGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015224
FAM208A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 208, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015224.3-4141s21c1
Sequence:CCGGGTCCCATCAGTTTAGTCATTTCTCGAGAAATGACTAAACTGATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015224.3-4114s21c1
Sequence:CCGGTCAGGTTTATCATAGTCAATTCTCGAGAATTGACTATGATAAACCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015224.3-2778s21c1
Sequence:CCGGAGCATTCCACTTCGGCTTTAACTCGAGTTAAAGCCGAAGTGGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015224.1-2410s1c1
Sequence:CCGGGTTCCCATTGAACATGGATTTCTCGAGAAATCCATGTTCAATGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167641    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015224.1-6128s1c1
Sequence:CCGGGCCCTGAAATCACATTGATATCTCGAGATATCAATGTGATTTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167047    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015224.1-5747s1c1
Sequence:CCGGCGCCAGACTATATTAAGGTAACTCGAGTTACCTTAATATAGTCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015224.1-3703s1c1
Sequence:CCGGCAATGGAAAGTCCACTGTAAACTCGAGTTTACAGTGGACTTTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015224.1-3466s1c1
Sequence:CCGGGCAGGTTTCATTCACAAGATACTCGAGTATCTTGTGAATGAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166998    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015224.1-4364s1c1
Sequence:CCGGGCAATTCAACAGAACAAGATTCTCGAGAATCTTGTTCTGTTGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015224
FAM208A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 208, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015224.3-4141s21c1
Sequence:CCGGGTCCCATCAGTTTAGTCATTTCTCGAGAAATGACTAAACTGATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015224.3-4114s21c1
Sequence:CCGGTCAGGTTTATCATAGTCAATTCTCGAGAATTGACTATGATAAACCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015224.3-2778s21c1
Sequence:CCGGAGCATTCCACTTCGGCTTTAACTCGAGTTAAAGCCGAAGTGGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015224.1-2410s1c1
Sequence:CCGGGTTCCCATTGAACATGGATTTCTCGAGAAATCCATGTTCAATGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167641    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015224.1-6128s1c1
Sequence:CCGGGCCCTGAAATCACATTGATATCTCGAGATATCAATGTGATTTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167047    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015224.1-5747s1c1
Sequence:CCGGCGCCAGACTATATTAAGGTAACTCGAGTTACCTTAATATAGTCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015224.1-3703s1c1
Sequence:CCGGCAATGGAAAGTCCACTGTAAACTCGAGTTTACAGTGGACTTTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015224.1-3466s1c1
Sequence:CCGGGCAGGTTTCATTCACAAGATACTCGAGTATCTTGTGAATGAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166998    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015224.1-4364s1c1
Sequence:CCGGGCAATTCAACAGAACAAGATTCTCGAGAATCTTGTTCTGTTGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks