EMAIL THIS PAGE TO A FRIEND

FAM208B

family with sequence similarity 208, member B

89 Gene Product Result for
Synonyms: C10orf18 bA318E3.2
Gene ID:
Rat(361269) family with sequence similarity 208, member B
Zebrafish(100003721) family with sequence similarity 208, member B
domestic cat(101081473) family with sequence similarity 208, member B
cow(785666) family with sequence similarity 208, member B
dog(478015) family with sequence similarity 208, member B
chicken(416689) family with sequence similarity 208, member B
sheep(101107038) family with sequence similarity 208, member B
domestic guinea pig(100716467) family with sequence similarity 208, member B
naked mole-rat(101718932) family with sequence similarity 208, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017782 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075351 MISSION® esiRNA esiRNA human C10orf18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017782 Rosetta Predictions human pricing
XM_374765 Rosetta Predictions human pricing
XM_931567 Rosetta Predictions human pricing
XM_931574 Rosetta Predictions human pricing
XM_001068906 Rosetta Predictions rat pricing
XM_341552 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350629 predicted 3401
2 SASI_Hs02_00350630 predicted 7903
3 SASI_Hs02_00350631 predicted 7673
4 SASI_Hs02_00350632 predicted 2472
5 SASI_Hs02_00350633 predicted 3989
6 SASI_Hs02_00350634 predicted 1630
7 SASI_Hs02_00350635 predicted 4810
8 SASI_Hs02_00350636 predicted 6941
9 SASI_Hs02_00350637 predicted 3899
10 SASI_Hs02_00350638 predicted 2218
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_374765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252924 predicted 6929
2 SASI_Hs01_00252925 predicted 6537
3 SASI_Hs01_00252926 predicted 7092
4 SASI_Hs01_00252927 predicted 6466
5 SASI_Hs01_00252928 predicted 7287
6 SASI_Hs01_00252929 predicted 7016
7 SASI_Hs01_00252930 predicted 7114
8 SASI_Hs01_00252931 predicted 6950
9 SASI_Hs01_00252932 predicted 7560
10 SASI_Hs01_00252933 predicted 7488
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290827 predicted 3237
2 SASI_Hs01_00290828 predicted 2841
3 SASI_Hs01_00290829 predicted 3395
4 SASI_Hs01_00290830 predicted 2766
5 SASI_Hs01_00290831 predicted 3603
6 SASI_Hs01_00290832 predicted 3325
7 SASI_Hs01_00290833 predicted 3428
8 SASI_Hs01_00290834 predicted 3258
9 SASI_Hs01_00290835 predicted 3862
10 SASI_Hs01_00290836 predicted 3794
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270359 predicted 420
2 SASI_Hs01_00270360 predicted 469
3 SASI_Hs01_00270361 predicted 298
4 SASI_Hs01_00270362 predicted 205
5 SASI_Hs01_00270363 predicted 551
6 SASI_Hs01_00270364 predicted 303
7 SASI_Hs01_00270365 predicted 221
8 SASI_Hs01_00270366 predicted 411
9 SASI_Hs01_00270367 predicted 309
10 SASI_Hs01_00270368 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326244 predicted 5612
2 SASI_Rn02_00326245 predicted 420
3 SASI_Rn02_00326246 predicted 1632
4 SASI_Rn02_00326247 predicted 6521
5 SASI_Rn02_00326248 predicted 807
6 SASI_Rn02_00326249 predicted 2455
7 SASI_Rn02_00326250 predicted 1423
8 SASI_Rn02_00326251 predicted 6952
9 SASI_Rn02_00326252 predicted 2769
10 SASI_Rn02_00326253 predicted 6357
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393079 predicted 5608
2 SASI_Rn02_00393080 predicted 421
3 SASI_Rn02_00393081 predicted 1632
4 SASI_Rn02_00393082 predicted 6519
5 SASI_Rn02_00393083 predicted 802
6 SASI_Rn02_00393084 predicted 2456
7 SASI_Rn02_00393085 predicted 1423
8 SASI_Rn02_00393086 predicted 6952
9 SASI_Rn02_00393087 predicted 2777
10 SASI_Rn02_00393088 predicted 6356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017782
FAM208B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 208, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017782.3-5052s21c1
Sequence:CCGGCTGCCGAAATGCCTCTAATATCTCGAGATATTAGAGGCATTTCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017782.3-2210s21c1
Sequence:CCGGTATGACTCCCAGGCCCTAAATCTCGAGATTTAGGGCCTGGGAGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017782.3-2232s21c1
Sequence:CCGGTGTTAGCCGATCTAGCATTAACTCGAGTTAATGCTAGATCGGCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017782.3-8785s21c1
Sequence:CCGGTACACCGAGTAACAGGTTAAACTCGAGTTTAACCTGTTACTCGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017782.3-1637s21c1
Sequence:CCGGCCATTGAGTCCAGCGTCAAATCTCGAGATTTGACGCTGGACTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017782
FAM208B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 208, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017782.3-5052s21c1
Sequence:CCGGCTGCCGAAATGCCTCTAATATCTCGAGATATTAGAGGCATTTCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017782.3-2210s21c1
Sequence:CCGGTATGACTCCCAGGCCCTAAATCTCGAGATTTAGGGCCTGGGAGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017782.3-2232s21c1
Sequence:CCGGTGTTAGCCGATCTAGCATTAACTCGAGTTAATGCTAGATCGGCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017782.3-8785s21c1
Sequence:CCGGTACACCGAGTAACAGGTTAAACTCGAGTTTAACCTGTTACTCGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017782.3-1637s21c1
Sequence:CCGGCCATTGAGTCCAGCGTCAAATCTCGAGATTTGACGCTGGACTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017782
FAM208B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 208, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017782.3-5052s21c1
Sequence:CCGGCTGCCGAAATGCCTCTAATATCTCGAGATATTAGAGGCATTTCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017782.3-2210s21c1
Sequence:CCGGTATGACTCCCAGGCCCTAAATCTCGAGATTTAGGGCCTGGGAGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017782.3-2232s21c1
Sequence:CCGGTGTTAGCCGATCTAGCATTAACTCGAGTTAATGCTAGATCGGCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017782.3-8785s21c1
Sequence:CCGGTACACCGAGTAACAGGTTAAACTCGAGTTTAACCTGTTACTCGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017782.3-1637s21c1
Sequence:CCGGCCATTGAGTCCAGCGTCAAATCTCGAGATTTGACGCTGGACTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks