EMAIL THIS PAGE TO A FRIEND

FAM209A

family with sequence similarity 209, member A

40 Gene Product Result for
Synonyms: C20orf106 dJ1153D9.3
UniProtKB ID: Q5JX71, Q05C43
Gene ID:
Rat(296411) family with sequence similarity 209, member A
sheep(101118805) family with sequence similarity 209, member A
domestic cat(101094662) family with sequence similarity 209, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012971 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012971 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012971 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012971 Rosetta Predictions human pricing
NM_001106548 Rosetta Predictions rat pricing
XM_215953 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015648 predicted 646
2 SASI_Hs01_00015650 predicted 413
3 SASI_Hs01_00015651 predicted 661
4 SASI_Hs01_00015652 predicted 680
5 SASI_Hs01_00015653 predicted 574
6 SASI_Hs01_00015654 predicted 415
7 SASI_Hs01_00015655 predicted 668
8 SASI_Hs01_00015656 predicted 691
9 SASI_Hs02_00306271 predicted 785
10 SASI_Hs02_00306272 predicted 735
11 SASI_Hs01_00015647 predicted 601
12 SASI_Hs01_00015649 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220038 predicted 361
2 SASI_Rn02_00220039 predicted 250
3 SASI_Rn02_00220040 predicted 339
4 SASI_Rn02_00220041 predicted 364
5 SASI_Rn02_00220042 predicted 325
6 SASI_Rn02_00220043 predicted 372
7 SASI_Rn02_00220044 predicted 339
8 SASI_Rn02_00220045 predicted 412
9 SASI_Rn02_00220046 predicted 264
10 SASI_Rn02_00220047 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00140887 predicted 325
2 SASI_Rn01_00140888 predicted 202
3 SASI_Rn01_00140889 predicted 321
4 SASI_Rn01_00140890 predicted 322
5 SASI_Rn01_00140891 predicted 325
6 SASI_Rn01_00140892 predicted 279
7 SASI_Rn01_00140893 predicted 361
8 SASI_Rn01_00140894 predicted 227
9 SASI_Rn01_00140895 predicted 352
10 SASI_Rn01_00140896 predicted 360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012971
FAM209A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 209, member A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012971.3-463s21c1
Sequence:CCGGCCAAAGTGCGGAATCTTAAACCTCGAGGTTTAAGATTCCGCACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012971.3-507s21c1
Sequence:CCGGAGTAACCTCAGGCTTCGAAAGCTCGAGCTTTCGAAGCCTGAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012971.3-436s21c1
Sequence:CCGGTCGAGGTGGAGCTTATGAAATCTCGAGATTTCATAAGCTCCACCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012971.3-186s21c1
Sequence:CCGGGTGCAATACGGAGAGCACTTTCTCGAGAAAGTGCTCTCCGTATTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012971.3-252s21c1
Sequence:CCGGAGCAAATGGCTCTGGCTTCTTCTCGAGAAGAAGCCAGAGCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012971.1-539s1c1
Sequence:CCGGGTTCTCTTCTCTGAGACAGAACTCGAGTTCTGTCTCAGAGAAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012971.1-842s1c1
Sequence:CCGGGCTTATGAAATTTGTGTCCAACTCGAGTTGGACACAAATTTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012971.1-855s1c1
Sequence:CCGGGTGTCCAAAGTGCGGAATCTTCTCGAGAAGATTCCGCACTTTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012971
FAM209A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 209, member A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012971.3-463s21c1
Sequence:CCGGCCAAAGTGCGGAATCTTAAACCTCGAGGTTTAAGATTCCGCACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012971.3-507s21c1
Sequence:CCGGAGTAACCTCAGGCTTCGAAAGCTCGAGCTTTCGAAGCCTGAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012971.3-436s21c1
Sequence:CCGGTCGAGGTGGAGCTTATGAAATCTCGAGATTTCATAAGCTCCACCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012971.3-186s21c1
Sequence:CCGGGTGCAATACGGAGAGCACTTTCTCGAGAAAGTGCTCTCCGTATTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012971.3-252s21c1
Sequence:CCGGAGCAAATGGCTCTGGCTTCTTCTCGAGAAGAAGCCAGAGCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012971.1-539s1c1
Sequence:CCGGGTTCTCTTCTCTGAGACAGAACTCGAGTTCTGTCTCAGAGAAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012971.1-842s1c1
Sequence:CCGGGCTTATGAAATTTGTGTCCAACTCGAGTTGGACACAAATTTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012971.1-855s1c1
Sequence:CCGGGTGTCCAAAGTGCGGAATCTTCTCGAGAAGATTCCGCACTTTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012971
FAM209A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 209, member A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012971.3-463s21c1
Sequence:CCGGCCAAAGTGCGGAATCTTAAACCTCGAGGTTTAAGATTCCGCACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012971.3-507s21c1
Sequence:CCGGAGTAACCTCAGGCTTCGAAAGCTCGAGCTTTCGAAGCCTGAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012971.3-436s21c1
Sequence:CCGGTCGAGGTGGAGCTTATGAAATCTCGAGATTTCATAAGCTCCACCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012971.3-186s21c1
Sequence:CCGGGTGCAATACGGAGAGCACTTTCTCGAGAAAGTGCTCTCCGTATTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012971.3-252s21c1
Sequence:CCGGAGCAAATGGCTCTGGCTTCTTCTCGAGAAGAAGCCAGAGCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012971.1-539s1c1
Sequence:CCGGGTTCTCTTCTCTGAGACAGAACTCGAGTTCTGTCTCAGAGAAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012971.1-842s1c1
Sequence:CCGGGCTTATGAAATTTGTGTCCAACTCGAGTTGGACACAAATTTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012971.1-855s1c1
Sequence:CCGGGTGTCCAAAGTGCGGAATCTTCTCGAGAAGATTCCGCACTTTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks