EMAIL THIS PAGE TO A FRIEND

FAM209B

family with sequence similarity 209, member B

17 Gene Product Result for
Synonyms: C20orf107 dJ1153D9.4
UniProtKB ID: Q5JX69, Q3KRB5
Gene ID:
cow(784495) family with sequence similarity 209, member B
dog(611771) family with sequence similarity 209, member B
domestic guinea pig(100720115) family with sequence similarity 209, member B
naked mole-rat(101709786) family with sequence similarity 209, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013646 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013646 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066158 predicted 365
2 SASI_Hs01_00066159 predicted 373
3 SASI_Hs01_00066160 predicted 368
4 SASI_Hs01_00066157 predicted 407
5 SASI_Hs01_00066161 predicted 404
6 SASI_Hs01_00066162 predicted 368
7 SASI_Hs01_00066163 predicted 363
8 SASI_Hs01_00066164 predicted 471
9 SASI_Hs01_00066165 predicted 559
10 SASI_Hs01_00066166 predicted 470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013646
FAM209B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 209, member B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000172728    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013646.1-1100s1c1
Sequence:CCGGGCAGTAACCTCAAGCTTCGAACTCGAGTTCGAAGCTTGAGGTTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172679    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013646.1-871s1c1
Sequence:CCGGGCTGTTGTGCCGTTTGTGATACTCGAGTATCACAAACGGCACAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013646.1-518s1c1
Sequence:CCGGCCTGTAACCTCTGTCCTGAAACTCGAGTTTCAGGACAGAGGTTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013646.1-1014s1c1
Sequence:CCGGCAATACCTTAAACGAACTTGACTCGAGTCAAGTTCGTTTAAGGTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013646
FAM209B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 209, member B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000172728    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013646.1-1100s1c1
Sequence:CCGGGCAGTAACCTCAAGCTTCGAACTCGAGTTCGAAGCTTGAGGTTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172679    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013646.1-871s1c1
Sequence:CCGGGCTGTTGTGCCGTTTGTGATACTCGAGTATCACAAACGGCACAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013646.1-518s1c1
Sequence:CCGGCCTGTAACCTCTGTCCTGAAACTCGAGTTTCAGGACAGAGGTTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013646.1-1014s1c1
Sequence:CCGGCAATACCTTAAACGAACTTGACTCGAGTCAAGTTCGTTTAAGGTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013646
FAM209B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 209, member B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000172728    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013646.1-1100s1c1
Sequence:CCGGGCAGTAACCTCAAGCTTCGAACTCGAGTTCGAAGCTTGAGGTTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172679    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013646.1-871s1c1
Sequence:CCGGGCTGTTGTGCCGTTTGTGATACTCGAGTATCACAAACGGCACAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013646.1-518s1c1
Sequence:CCGGCCTGTAACCTCTGTCCTGAAACTCGAGTTTCAGGACAGAGGTTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013646.1-1014s1c1
Sequence:CCGGCAATACCTTAAACGAACTTGACTCGAGTCAAGTTCGTTTAAGGTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)