EMAIL THIS PAGE TO A FRIEND

FAM20A

family with sequence similarity 20, member A

Synonyms: AIGFS FP2747
UniProtKB ID: Q96MK3, B2RN47, B2RN49, Q9UF95
Gene ID:
Human(54757) Summary: This locus encodes a protein that is likely secreted and may function in hematopoiesis. A mutation at this locus has been associated with amelogenesis imperfecta and gingival hyperplasia syndrome. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
Mouse(208659) family with sequence similarity 20, member A
Rat(303635) family with sequence similarity 20, member A
naked mole-rat(101723359) family with sequence similarity 20, member A
domestic guinea pig(100715863) family with sequence similarity 20, member A
sheep(101108764) family with sequence similarity 20, member A
Zebrafish(564308) family with sequence similarity 20, member A
cow(521099) family with sequence similarity 20, member A
domestic cat(101088893) family with sequence similarity 20, member A
dog(480458) family with sequence similarity 20, member A
chicken(417439) family with sequence similarity 20, member A
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017565 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153782 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153782 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153782 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017565 Rosetta Predictions human pricing
NM_001012237 Rosetta Predictions rat pricing
XM_001081597 Rosetta Predictions rat pricing
XM_573215 Rosetta Predictions rat pricing
NM_153782 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116600 predicted 969
2 SASI_Hs01_00116601 predicted 1996
3 SASI_Hs01_00116602 predicted 778
4 SASI_Hs02_00350222 predicted 1142
5 SASI_Hs01_00116603 predicted 1167
6 SASI_Hs01_00116606 predicted 2004
7 SASI_Hs01_00116608 predicted 1506
8 SASI_Hs01_00116609 predicted 823
9 SASI_Hs02_00350223 predicted 869
10 SASI_Hs02_00350224 predicted 902
11 SASI_Hs01_00116604 predicted 1490
12 SASI_Hs01_00116605 predicted 1015
13 SASI_Hs01_00116607 predicted 1909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200500 predicted 1140
2 SASI_Rn02_00200501 predicted 1400
3 SASI_Rn02_00200502 predicted 1195
4 SASI_Rn02_00200503 predicted 265
5 SASI_Rn02_00200504 predicted 581
6 SASI_Rn02_00200505 predicted 924
7 SASI_Rn02_00200506 predicted 970
8 SASI_Rn02_00200507 predicted 924
9 SASI_Rn02_00200508 predicted 1268
10 SASI_Rn02_00200509 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372579 predicted 1694
2 SASI_Rn02_00372580 predicted 1953
3 SASI_Rn02_00372581 predicted 1752
4 SASI_Rn02_00372582 predicted 817
5 SASI_Rn02_00372583 predicted 1137
6 SASI_Rn02_00372584 predicted 1470
7 SASI_Rn02_00372585 predicted 1523
8 SASI_Rn02_00372586 predicted 1823
9 SASI_Rn02_00372587 predicted 1510
10 SASI_Rn02_00372588 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400024 predicted 1688
2 SASI_Rn02_00400025 predicted 1946
3 SASI_Rn02_00400026 predicted 1749
4 SASI_Rn02_00400027 predicted 1811
5 SASI_Rn02_00400028 predicted 1816
6 SASI_Rn02_00400029 predicted 1820
7 SASI_Rn02_00400030 predicted 1849
8 SASI_Rn02_00400031 predicted 1782
9 SASI_Rn02_00400032 predicted 1686
10 SASI_Rn02_00400033 predicted 1683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025072 predicted 1685
2 SASI_Mm02_00343505 predicted 1394
3 SASI_Mm01_00025074 predicted 1944
4 SASI_Mm01_00025075 predicted 1460
5 SASI_Mm01_00025076 predicted 1125
6 SASI_Mm01_00025077 predicted 1718
7 SASI_Mm01_00025078 predicted 1805
8 SASI_Mm01_00025079 predicted 936
9 SASI_Mm01_00025080 predicted 1465
10 SASI_Mm01_00025081 predicted 1499
11 SASI_Mm01_00025073 predicted 1856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017565
FAM20A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 20, member A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017565.2-1494s1c1
Sequence:CCGGCGACTTCTTGATAGGGAATATCTCGAGATATTCCCTATCAAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017565.2-1038s1c1
Sequence:CCGGCTTCTTCTACTTCATTGACTTCTCGAGAAGTCAATGAAGTAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017565.2-1050s1c1
Sequence:CCGGCATTGACTTTCAGAGACACAACTCGAGTTGTGTCTCTGAAAGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017565.2-1464s1c1
Sequence:CCGGGCTCCTCAATGTCATCGACATCTCGAGATGTCGATGACATTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017565.2-1137s1c1
Sequence:CCGGGAGGATAGTAAATGTCACCAACTCGAGTTGGTGACATTTACTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017565.3-1707s21c1
Sequence:CCGGCAGCGATGTGATGCGAGAATCCTCGAGGATTCTCGCATCACATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017565.3-2339s21c1
Sequence:CCGGGCCTATCACAAGCTGACTAAACTCGAGTTTAGTCAGCTTGTGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017565
FAM20A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 20, member A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017565.2-1494s1c1
Sequence:CCGGCGACTTCTTGATAGGGAATATCTCGAGATATTCCCTATCAAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017565.2-1038s1c1
Sequence:CCGGCTTCTTCTACTTCATTGACTTCTCGAGAAGTCAATGAAGTAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017565.2-1050s1c1
Sequence:CCGGCATTGACTTTCAGAGACACAACTCGAGTTGTGTCTCTGAAAGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017565.2-1464s1c1
Sequence:CCGGGCTCCTCAATGTCATCGACATCTCGAGATGTCGATGACATTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017565.2-1137s1c1
Sequence:CCGGGAGGATAGTAAATGTCACCAACTCGAGTTGGTGACATTTACTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017565.3-1707s21c1
Sequence:CCGGCAGCGATGTGATGCGAGAATCCTCGAGGATTCTCGCATCACATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017565.3-2339s21c1
Sequence:CCGGGCCTATCACAAGCTGACTAAACTCGAGTTTAGTCAGCTTGTGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017565
FAM20A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 20, member A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017565.2-1494s1c1
Sequence:CCGGCGACTTCTTGATAGGGAATATCTCGAGATATTCCCTATCAAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017565.2-1038s1c1
Sequence:CCGGCTTCTTCTACTTCATTGACTTCTCGAGAAGTCAATGAAGTAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017565.2-1050s1c1
Sequence:CCGGCATTGACTTTCAGAGACACAACTCGAGTTGTGTCTCTGAAAGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017565.2-1464s1c1
Sequence:CCGGGCTCCTCAATGTCATCGACATCTCGAGATGTCGATGACATTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017565.2-1137s1c1
Sequence:CCGGGAGGATAGTAAATGTCACCAACTCGAGTTGGTGACATTTACTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017565.3-1707s21c1
Sequence:CCGGCAGCGATGTGATGCGAGAATCCTCGAGGATTCTCGCATCACATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017565.3-2339s21c1
Sequence:CCGGGCCTATCACAAGCTGACTAAACTCGAGTTTAGTCAGCTTGTGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153782
FAM20A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 20, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153782.1-2325s1c1
Sequence:CCGGCTGAACCTCATCTTTATCCTTCTCGAGAAGGATAAAGATGAGGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153782.1-947s1c1
Sequence:CCGGCGGCACAAGATATACAAAGAACTCGAGTTCTTTGTATATCTTGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153782.1-1808s1c1
Sequence:CCGGGATGGATACCTTATTCATCTTCTCGAGAAGATGAATAAGGTATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153782.1-1093s1c1
Sequence:CCGGCCTCCATGACATGAGACACTTCTCGAGAAGTGTCTCATGTCATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153782.1-1204s1c1
Sequence:CCGGCCTGAAATTGGTTCTGAGGTTCTCGAGAACCTCAGAACCAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153782
FAM20A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 20, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153782.1-2325s1c1
Sequence:CCGGCTGAACCTCATCTTTATCCTTCTCGAGAAGGATAAAGATGAGGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153782.1-947s1c1
Sequence:CCGGCGGCACAAGATATACAAAGAACTCGAGTTCTTTGTATATCTTGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153782.1-1808s1c1
Sequence:CCGGGATGGATACCTTATTCATCTTCTCGAGAAGATGAATAAGGTATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153782.1-1093s1c1
Sequence:CCGGCCTCCATGACATGAGACACTTCTCGAGAAGTGTCTCATGTCATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153782.1-1204s1c1
Sequence:CCGGCCTGAAATTGGTTCTGAGGTTCTCGAGAACCTCAGAACCAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153782
FAM20A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 20, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153782.1-2325s1c1
Sequence:CCGGCTGAACCTCATCTTTATCCTTCTCGAGAAGGATAAAGATGAGGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153782.1-947s1c1
Sequence:CCGGCGGCACAAGATATACAAAGAACTCGAGTTCTTTGTATATCTTGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153782.1-1808s1c1
Sequence:CCGGGATGGATACCTTATTCATCTTCTCGAGAAGATGAATAAGGTATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153782.1-1093s1c1
Sequence:CCGGCCTCCATGACATGAGACACTTCTCGAGAAGTGTCTCATGTCATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153782.1-1204s1c1
Sequence:CCGGCCTGAAATTGGTTCTGAGGTTCTCGAGAACCTCAGAACCAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks