EMAIL THIS PAGE TO A FRIEND

FAM20B

family with sequence similarity 20, member B

57 Gene Product Result for
Synonyms: gxk1
UniProtKB ID: O75063, Q5W0C3, Q5W0C4
Gene ID:
Mouse(215015) family with sequence similarity 20, member B
Rat(304885) family with sequence similarity 20, member B
Zebrafish(557060) family with sequence similarity 20, member B (H. sapiens)
cow(539755) family with sequence similarity 20, member B
domestic cat(101080504) family with sequence similarity 20, member B
dog(480053) family with sequence similarity 20, member B
chicken(424427) family with sequence similarity 20, member B
sheep(101120593) family with sequence similarity 20, member B
domestic guinea pig(100717019) family with sequence similarity 20, member B
naked mole-rat(101707016) family with sequence similarity 20, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA007409 Anti-FAM20B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014864 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143781 MISSION® esiRNA esiRNA human FAM20B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014864 Rosetta Predictions human pricing
NM_001107187 Rosetta Predictions rat pricing
NM_145413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346448 predicted 1204
2 SASI_Hs01_00210460 predicted 738
3 SASI_Hs01_00210462 predicted 773
4 SASI_Hs01_00210463 predicted 887
5 SASI_Hs01_00210465 predicted 1265
6 SASI_Hs01_00210467 predicted 571
7 SASI_Hs01_00210468 predicted 701
8 SASI_Hs02_00346449 predicted 734
9 SASI_Hs02_00346450 predicted 808
10 SASI_Hs02_00346451 predicted 1159
11 SASI_Hs01_00210459 predicted 1199
12 SASI_Hs01_00210461 predicted 617
13 SASI_Hs01_00210464 predicted 955
14 SASI_Hs01_00210466 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107187 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226365 predicted 1478
2 SASI_Rn02_00226366 predicted 1436
3 SASI_Rn02_00226367 predicted 1179
4 SASI_Rn02_00226368 predicted 255
5 SASI_Rn02_00226369 predicted 916
6 SASI_Rn02_00226370 predicted 1213
7 SASI_Rn02_00226371 predicted 1113
8 SASI_Rn02_00226372 predicted 784
9 SASI_Rn02_00226373 predicted 274
10 SASI_Rn02_00226374 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340747 predicted 578
2 SASI_Mm01_00062866 predicted 1072
3 SASI_Mm01_00062867 predicted 909
4 SASI_Mm02_00340748 predicted 1072
5 SASI_Mm01_00062868 predicted 725
6 SASI_Mm01_00062870 predicted 1144
7 SASI_Mm02_00340749 predicted 1382
8 SASI_Mm01_00062871 predicted 751
9 SASI_Mm02_00340750 predicted 1191
10 SASI_Mm01_00062873 predicted 827
11 SASI_Mm01_00062865 predicted 961
12 SASI_Mm01_00062869 predicted 417
13 SASI_Mm01_00062872 predicted 1625
14 SASI_Mm01_00062874 predicted 1393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145413
VALIDATED
FAM20B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 20, member B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145413.4-1391s21c1
Sequence:CCGGACTTGTAATTCTCAACGCAAACTCGAGTTTGCGTTGAGAATTACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145413.4-459s21c1
Sequence:CCGGTAAAGCTGACGTGGGCTATAACTCGAGTTATAGCCCACGTCAGCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145413.4-1200s21c1
Sequence:CCGGTCTAAAGAATGGAGTACTAAACTCGAGTTTAGTACTCCATTCTTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145413.4-731s21c1
Sequence:CCGGTCCTAACTGTAGGGAACAATACTCGAGTATTGTTCCCTACAGTTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145413.4-678s21c1
Sequence:CCGGTAATCTGCGGACAGAAGTTAACTCGAGTTAACTTCTGTCCGCAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145413.4-1444s21c1
Sequence:CCGGACAGCACAATCAATTCCAAATCTCGAGATTTGGAATTGATTGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145413.2-1362s1c1
Sequence:CCGGCCCTCTCTATCAGTGTTGCATCTCGAGATGCAACACTGATAGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145413.2-712s1c1
Sequence:CCGGGCTTTACTGATTCTTGAAGGACTCGAGTCCTTCAAGAATCAGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145413.2-411s1c1
Sequence:CCGGGTTAGCAATACTCCTCGTCATCTCGAGATGACGAGGAGTATTGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145413.2-884s1c1
Sequence:CCGGGCAGATATGTTAATCTGCGAACTCGAGTTCGCAGATTAACATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145413
VALIDATED
FAM20B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 20, member B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145413.4-1391s21c1
Sequence:CCGGACTTGTAATTCTCAACGCAAACTCGAGTTTGCGTTGAGAATTACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145413.4-459s21c1
Sequence:CCGGTAAAGCTGACGTGGGCTATAACTCGAGTTATAGCCCACGTCAGCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145413.4-1200s21c1
Sequence:CCGGTCTAAAGAATGGAGTACTAAACTCGAGTTTAGTACTCCATTCTTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145413.4-731s21c1
Sequence:CCGGTCCTAACTGTAGGGAACAATACTCGAGTATTGTTCCCTACAGTTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145413.4-678s21c1
Sequence:CCGGTAATCTGCGGACAGAAGTTAACTCGAGTTAACTTCTGTCCGCAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145413.4-1444s21c1
Sequence:CCGGACAGCACAATCAATTCCAAATCTCGAGATTTGGAATTGATTGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145413.2-1362s1c1
Sequence:CCGGCCCTCTCTATCAGTGTTGCATCTCGAGATGCAACACTGATAGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145413.2-712s1c1
Sequence:CCGGGCTTTACTGATTCTTGAAGGACTCGAGTCCTTCAAGAATCAGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145413.2-411s1c1
Sequence:CCGGGTTAGCAATACTCCTCGTCATCTCGAGATGACGAGGAGTATTGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145413.2-884s1c1
Sequence:CCGGGCAGATATGTTAATCTGCGAACTCGAGTTCGCAGATTAACATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145413
VALIDATED
FAM20B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 20, member B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145413.4-1391s21c1
Sequence:CCGGACTTGTAATTCTCAACGCAAACTCGAGTTTGCGTTGAGAATTACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145413.4-459s21c1
Sequence:CCGGTAAAGCTGACGTGGGCTATAACTCGAGTTATAGCCCACGTCAGCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145413.4-1200s21c1
Sequence:CCGGTCTAAAGAATGGAGTACTAAACTCGAGTTTAGTACTCCATTCTTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145413.4-731s21c1
Sequence:CCGGTCCTAACTGTAGGGAACAATACTCGAGTATTGTTCCCTACAGTTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145413.4-678s21c1
Sequence:CCGGTAATCTGCGGACAGAAGTTAACTCGAGTTAACTTCTGTCCGCAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145413.4-1444s21c1
Sequence:CCGGACAGCACAATCAATTCCAAATCTCGAGATTTGGAATTGATTGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145413.2-1362s1c1
Sequence:CCGGCCCTCTCTATCAGTGTTGCATCTCGAGATGCAACACTGATAGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145413.2-712s1c1
Sequence:CCGGGCTTTACTGATTCTTGAAGGACTCGAGTCCTTCAAGAATCAGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145413.2-411s1c1
Sequence:CCGGGTTAGCAATACTCCTCGTCATCTCGAGATGACGAGGAGTATTGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145413.2-884s1c1
Sequence:CCGGGCAGATATGTTAATCTGCGAACTCGAGTTCGCAGATTAACATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014864
VALIDATED
FAM20B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 20, member B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014864.3-1128s21c1
Sequence:CCGGGCTGTCTTTGATTACCTGATTCTCGAGAATCAGGTAATCAAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014864.3-921s21c1
Sequence:CCGGGCTTGTGCTGATGGAGACATACTCGAGTATGTCTCCATCAGCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014864.3-1502s21c1
Sequence:CCGGGATGCCTCTCTCACACTTGTACTCGAGTACAAGTGTGAGAGAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014864.3-741s21c1
Sequence:CCGGGCCTTTCACTTGGACAGGATTCTCGAGAATCCTGTCCAAGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014864.3-5225s21c1
Sequence:CCGGCGTGTATTCTTTGACCAGTAACTCGAGTTACTGGTCAAAGAATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014864.2-741s1c1
Sequence:CCGGGCCTTTCACTTGGACAGGATTCTCGAGAATCCTGTCCAAGTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014864.2-1502s1c1
Sequence:CCGGGATGCCTCTCTCACACTTGTACTCGAGTACAAGTGTGAGAGAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014864.2-5226s1c1
Sequence:CCGGCGTGTATTCTTTGACCAGTAACTCGAGTTACTGGTCAAAGAATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014864.2-1128s1c1
Sequence:CCGGGCTGTCTTTGATTACCTGATTCTCGAGAATCAGGTAATCAAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014864.2-853s1c1
Sequence:CCGGCCTTCCTAACTGTAGGAAACACTCGAGTGTTTCCTACAGTTAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014864.2-921s1c1
Sequence:CCGGGCTTGTGCTGATGGAGACATACTCGAGTATGTCTCCATCAGCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014864.2-1055s1c1
Sequence:CCGGGAGCTACTGTGATGCTGTGAACTCGAGTTCACAGCATCACAGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014864
VALIDATED
FAM20B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 20, member B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014864.3-1128s21c1
Sequence:CCGGGCTGTCTTTGATTACCTGATTCTCGAGAATCAGGTAATCAAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014864.3-921s21c1
Sequence:CCGGGCTTGTGCTGATGGAGACATACTCGAGTATGTCTCCATCAGCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014864.3-1502s21c1
Sequence:CCGGGATGCCTCTCTCACACTTGTACTCGAGTACAAGTGTGAGAGAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014864.3-741s21c1
Sequence:CCGGGCCTTTCACTTGGACAGGATTCTCGAGAATCCTGTCCAAGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014864.3-5225s21c1
Sequence:CCGGCGTGTATTCTTTGACCAGTAACTCGAGTTACTGGTCAAAGAATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014864.2-741s1c1
Sequence:CCGGGCCTTTCACTTGGACAGGATTCTCGAGAATCCTGTCCAAGTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014864.2-1502s1c1
Sequence:CCGGGATGCCTCTCTCACACTTGTACTCGAGTACAAGTGTGAGAGAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014864.2-5226s1c1
Sequence:CCGGCGTGTATTCTTTGACCAGTAACTCGAGTTACTGGTCAAAGAATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014864.2-1128s1c1
Sequence:CCGGGCTGTCTTTGATTACCTGATTCTCGAGAATCAGGTAATCAAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014864.2-853s1c1
Sequence:CCGGCCTTCCTAACTGTAGGAAACACTCGAGTGTTTCCTACAGTTAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014864.2-921s1c1
Sequence:CCGGGCTTGTGCTGATGGAGACATACTCGAGTATGTCTCCATCAGCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014864.2-1055s1c1
Sequence:CCGGGAGCTACTGTGATGCTGTGAACTCGAGTTCACAGCATCACAGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014864
VALIDATED
FAM20B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 20, member B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014864.3-1128s21c1
Sequence:CCGGGCTGTCTTTGATTACCTGATTCTCGAGAATCAGGTAATCAAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014864.3-921s21c1
Sequence:CCGGGCTTGTGCTGATGGAGACATACTCGAGTATGTCTCCATCAGCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014864.3-1502s21c1
Sequence:CCGGGATGCCTCTCTCACACTTGTACTCGAGTACAAGTGTGAGAGAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014864.3-741s21c1
Sequence:CCGGGCCTTTCACTTGGACAGGATTCTCGAGAATCCTGTCCAAGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014864.3-5225s21c1
Sequence:CCGGCGTGTATTCTTTGACCAGTAACTCGAGTTACTGGTCAAAGAATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014864.2-741s1c1
Sequence:CCGGGCCTTTCACTTGGACAGGATTCTCGAGAATCCTGTCCAAGTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014864.2-1502s1c1
Sequence:CCGGGATGCCTCTCTCACACTTGTACTCGAGTACAAGTGTGAGAGAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014864.2-5226s1c1
Sequence:CCGGCGTGTATTCTTTGACCAGTAACTCGAGTTACTGGTCAAAGAATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014864.2-1128s1c1
Sequence:CCGGGCTGTCTTTGATTACCTGATTCTCGAGAATCAGGTAATCAAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014864.2-853s1c1
Sequence:CCGGCCTTCCTAACTGTAGGAAACACTCGAGTGTTTCCTACAGTTAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014864.2-921s1c1
Sequence:CCGGGCTTGTGCTGATGGAGACATACTCGAGTATGTCTCCATCAGCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014864.2-1055s1c1
Sequence:CCGGGAGCTACTGTGATGCTGTGAACTCGAGTTCACAGCATCACAGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks