EMAIL THIS PAGE TO A FRIEND

FAM20C

family with sequence similarity 20, member C

83 Gene Product Result for
Synonyms: DMP-4 DMP4 GEF-CK RNS
UniProtKB ID: Q8IXL6, A4D2Q5, Q5I0W9, Q7Z4I0, Q9NPT2
Gene ID:
Human(56975) Summary: This gene encodes a member of the family with sequence similarity 20 (FAM20) family of secreted proteins. A similar gene in mice encodes a protein that plays a role in dentin mineralization, and mutations in the human gene are associated with the autosomal recessive disorder Raine syndrome. [provided by RefSeq, Nov 2011]
Mouse(80752) family with sequence similarity 20, member C
Rat(304334) family with sequence similarity 20, member C
naked mole-rat(101725346) family with sequence similarity 20, member C
domestic guinea pig(100735924) family with sequence similarity 20, member C
Zebrafish(560397) family with sequence similarity 20, member C
chicken(416445) family with sequence similarity 20, member C
cow(534672) family with sequence similarity 20, member C
domestic cat(101086772) family with sequence similarity 20, member C
dog(491596) family with sequence similarity 20, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020223 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU051091 MISSION® esiRNA esiRNA targeting mouse Fam20c (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020223 Rosetta Predictions human pricing
XM_928334 Rosetta Predictions human pricing
NM_001012238 Rosetta Predictions rat pricing
XM_001074613 Rosetta Predictions rat pricing
XM_573367 Rosetta Predictions rat pricing
NM_030565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017674 predicted 2250
2 SASI_Hs01_00017675 predicted 2125
3 SASI_Hs02_00353164 predicted 2135
4 SASI_Hs01_00017676 predicted 895
5 SASI_Hs01_00017677 predicted 2403
6 SASI_Hs01_00017679 predicted 2318
7 SASI_Hs01_00017681 predicted 1955
8 SASI_Hs01_00017682 predicted 2303
9 SASI_Hs02_00353165 predicted 2322
10 SASI_Hs01_00017683 predicted 724
11 SASI_Hs01_00017678 predicted 1157
12 SASI_Hs01_00017680 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258100 predicted 766
2 SASI_Hs01_00258101 predicted 766
3 SASI_Hs01_00258102 predicted 754
4 SASI_Hs01_00258103 predicted 762
5 SASI_Hs01_00258104 predicted 765
6 SASI_Hs01_00258105 predicted 764
7 SASI_Hs01_00258106 predicted 726
8 SASI_Hs01_00258107 predicted 748
9 SASI_Hs01_00258108 predicted 760
10 SASI_Hs01_00258109 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200510 predicted 1912
2 SASI_Rn02_00200511 predicted 1600
3 SASI_Rn02_00200512 predicted 594
4 SASI_Rn02_00200513 predicted 802
5 SASI_Rn02_00200514 predicted 1176
6 SASI_Rn02_00200515 predicted 2293
7 SASI_Rn02_00200516 predicted 1196
8 SASI_Rn02_00200517 predicted 1724
9 SASI_Rn02_00200518 predicted 1838
10 SASI_Rn02_00200519 predicted 2188
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074613 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346806 predicted 2089
2 SASI_Rn02_00346807 predicted 1779
3 SASI_Rn02_00346808 predicted 778
4 SASI_Rn02_00346809 predicted 977
5 SASI_Rn02_00346810 predicted 1359
6 SASI_Rn02_00346811 predicted 2477
7 SASI_Rn02_00346812 predicted 1377
8 SASI_Rn02_00346813 predicted 1907
9 SASI_Rn02_00346814 predicted 2018
10 SASI_Rn02_00346815 predicted 2368
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573367 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400185 predicted 2095
2 SASI_Rn02_00400186 predicted 1785
3 SASI_Rn02_00400187 predicted 778
4 SASI_Rn02_00400188 predicted 982
5 SASI_Rn02_00400189 predicted 1356
6 SASI_Rn02_00400190 predicted 2481
7 SASI_Rn02_00400191 predicted 1377
8 SASI_Rn02_00400192 predicted 1908
9 SASI_Rn02_00400193 predicted 2021
10 SASI_Rn02_00400194 predicted 2370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135836 predicted 1875
2 SASI_Mm02_00336772 predicted 1366
3 SASI_Mm02_00336773 predicted 1189
4 SASI_Mm02_00336774 predicted 1801
5 SASI_Mm02_00336775 predicted 1554
6 SASI_Mm01_00135845 predicted 1765
7 SASI_Mm02_00336776 predicted 1940
8 SASI_Mm02_00336777 predicted 1387
9 SASI_Mm02_00336778 predicted 1020
10 SASI_Mm02_00336779 predicted 1195
11 SASI_Mm01_00135837 predicted 1978
12 SASI_Mm01_00135838 predicted 2577
13 SASI_Mm01_00135839 predicted 1548
14 SASI_Mm01_00135840 predicted 2606
15 SASI_Mm01_00135841 predicted 1834
16 SASI_Mm01_00135842 predicted 1828
17 SASI_Mm01_00135843 predicted 1587
18 SASI_Mm01_00135844 predicted 2487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020223
VALIDATED
FAM20C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 20, member C
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020223.1-1437s1c1
Sequence:CCGGCGACTTCCTCATGGGAAACATCTCGAGATGTTTCCCATGAGGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020223.1-1488s1c1
Sequence:CCGGGTTTGGGAATGAAACGTTCATCTCGAGATGAACGTTTCATTCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020223.1-768s1c1
Sequence:CCGGCAAGTTCCACATTGGTATCAACTCGAGTTGATACCAATGTGGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020223.1-1416s1c1
Sequence:CCGGCGTCATGGACATGACGATCTTCTCGAGAAGATCGTCATGTCCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020223.1-1146s1c1
Sequence:CCGGCTTCATCTCTCCAGCCAACAACTCGAGTTGTTGGCTGGAGAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020223.1-2182s1c1
Sequence:CCGGGCCAATCACCTACCAAACCAACTCGAGTTGGTTTGGTAGGTGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020223.1-1498s1c1
Sequence:CCGGGAAACGTTCATCATCCACTTACTCGAGTAAGTGGATGATGAACGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020223.1-2183s1c1
Sequence:CCGGCCAATCACCTACCAAACCAAACTCGAGTTTGGTTTGGTAGGTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020223.2-1642s21c1
Sequence:CCGGGAAACGTTCATCATCCACTTACTCGAGTAAGTGGATGATGAACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020223.2-1290s21c1
Sequence:CCGGCTTCATCTCTCCAGCCAACAACTCGAGTTGTTGGCTGGAGAGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020223.2-912s21c1
Sequence:CCGGCAAGTTCCACATTGGTATCAACTCGAGTTGATACCAATGTGGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020223.2-2327s21c1
Sequence:CCGGCCAATCACCTACCAAACCAAACTCGAGTTTGGTTTGGTAGGTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020223
VALIDATED
FAM20C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 20, member C
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020223.1-1437s1c1
Sequence:CCGGCGACTTCCTCATGGGAAACATCTCGAGATGTTTCCCATGAGGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020223.1-1488s1c1
Sequence:CCGGGTTTGGGAATGAAACGTTCATCTCGAGATGAACGTTTCATTCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020223.1-768s1c1
Sequence:CCGGCAAGTTCCACATTGGTATCAACTCGAGTTGATACCAATGTGGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020223.1-1416s1c1
Sequence:CCGGCGTCATGGACATGACGATCTTCTCGAGAAGATCGTCATGTCCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020223.1-1146s1c1
Sequence:CCGGCTTCATCTCTCCAGCCAACAACTCGAGTTGTTGGCTGGAGAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020223.1-2182s1c1
Sequence:CCGGGCCAATCACCTACCAAACCAACTCGAGTTGGTTTGGTAGGTGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020223.1-1498s1c1
Sequence:CCGGGAAACGTTCATCATCCACTTACTCGAGTAAGTGGATGATGAACGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020223.1-2183s1c1
Sequence:CCGGCCAATCACCTACCAAACCAAACTCGAGTTTGGTTTGGTAGGTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020223.2-1642s21c1
Sequence:CCGGGAAACGTTCATCATCCACTTACTCGAGTAAGTGGATGATGAACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020223.2-1290s21c1
Sequence:CCGGCTTCATCTCTCCAGCCAACAACTCGAGTTGTTGGCTGGAGAGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020223.2-912s21c1
Sequence:CCGGCAAGTTCCACATTGGTATCAACTCGAGTTGATACCAATGTGGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020223.2-2327s21c1
Sequence:CCGGCCAATCACCTACCAAACCAAACTCGAGTTTGGTTTGGTAGGTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020223
VALIDATED
FAM20C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 20, member C
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020223.1-1437s1c1
Sequence:CCGGCGACTTCCTCATGGGAAACATCTCGAGATGTTTCCCATGAGGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020223.1-1488s1c1
Sequence:CCGGGTTTGGGAATGAAACGTTCATCTCGAGATGAACGTTTCATTCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020223.1-768s1c1
Sequence:CCGGCAAGTTCCACATTGGTATCAACTCGAGTTGATACCAATGTGGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020223.1-1416s1c1
Sequence:CCGGCGTCATGGACATGACGATCTTCTCGAGAAGATCGTCATGTCCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020223.1-1146s1c1
Sequence:CCGGCTTCATCTCTCCAGCCAACAACTCGAGTTGTTGGCTGGAGAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020223.1-2182s1c1
Sequence:CCGGGCCAATCACCTACCAAACCAACTCGAGTTGGTTTGGTAGGTGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020223.1-1498s1c1
Sequence:CCGGGAAACGTTCATCATCCACTTACTCGAGTAAGTGGATGATGAACGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020223.1-2183s1c1
Sequence:CCGGCCAATCACCTACCAAACCAAACTCGAGTTTGGTTTGGTAGGTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020223.2-1642s21c1
Sequence:CCGGGAAACGTTCATCATCCACTTACTCGAGTAAGTGGATGATGAACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020223.2-1290s21c1
Sequence:CCGGCTTCATCTCTCCAGCCAACAACTCGAGTTGTTGGCTGGAGAGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020223.2-912s21c1
Sequence:CCGGCAAGTTCCACATTGGTATCAACTCGAGTTGATACCAATGTGGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020223.2-2327s21c1
Sequence:CCGGCCAATCACCTACCAAACCAAACTCGAGTTTGGTTTGGTAGGTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030565
VALIDATED
FAM20C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 20, member C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121462    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030565.5-2591s1c1
Sequence:CCGGGCCACTTCAAGGACCTTCTATCTCGAGATAGAAGGTCCTTGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030565.5-1554s1c1
Sequence:CCGGCGGGATAAGAAGCTATGGAGACTCGAGTCTCCATAGCTTCTTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030565.5-1850s1c1
Sequence:CCGGCATCATGGATATGACCGTCTTCTCGAGAAGACGGTCATATCCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030565.5-1911s1c1
Sequence:CCGGACCTTTGAGAAGTTCGGGAATCTCGAGATTCCCGAACTTCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030565.5-1980s1c1
Sequence:CCGGTCACACGATGAGCTTTCCATTCTCGAGAATGGAAAGCTCATCGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030565.6-1371s21c1
Sequence:CCGGGAATTACGGGCAGGCGCTATTCTCGAGAATAGCGCCTGCCCGTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030565.6-1206s21c1
Sequence:CCGGCTATCCCAACTGGCTCAAATTCTCGAGAATTTGAGCCAGTTGGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030565.6-2511s21c1
Sequence:CCGGCCCATAGGGAGGGACCTTTAACTCGAGTTAAAGGTCCCTCCCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030565.6-1869s21c1
Sequence:CCGGCATCATGGATATGACCGTCTTCTCGAGAAGACGGTCATATCCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030565.6-1930s21c1
Sequence:CCGGACCTTTGAGAAGTTCGGGAATCTCGAGATTCCCGAACTTCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030565
VALIDATED
FAM20C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 20, member C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121462    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030565.5-2591s1c1
Sequence:CCGGGCCACTTCAAGGACCTTCTATCTCGAGATAGAAGGTCCTTGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030565.5-1554s1c1
Sequence:CCGGCGGGATAAGAAGCTATGGAGACTCGAGTCTCCATAGCTTCTTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030565.5-1850s1c1
Sequence:CCGGCATCATGGATATGACCGTCTTCTCGAGAAGACGGTCATATCCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030565.5-1911s1c1
Sequence:CCGGACCTTTGAGAAGTTCGGGAATCTCGAGATTCCCGAACTTCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030565.5-1980s1c1
Sequence:CCGGTCACACGATGAGCTTTCCATTCTCGAGAATGGAAAGCTCATCGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030565.6-1371s21c1
Sequence:CCGGGAATTACGGGCAGGCGCTATTCTCGAGAATAGCGCCTGCCCGTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030565.6-1206s21c1
Sequence:CCGGCTATCCCAACTGGCTCAAATTCTCGAGAATTTGAGCCAGTTGGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030565.6-2511s21c1
Sequence:CCGGCCCATAGGGAGGGACCTTTAACTCGAGTTAAAGGTCCCTCCCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030565.6-1869s21c1
Sequence:CCGGCATCATGGATATGACCGTCTTCTCGAGAAGACGGTCATATCCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030565.6-1930s21c1
Sequence:CCGGACCTTTGAGAAGTTCGGGAATCTCGAGATTCCCGAACTTCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030565
VALIDATED
FAM20C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 20, member C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121462    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030565.5-2591s1c1
Sequence:CCGGGCCACTTCAAGGACCTTCTATCTCGAGATAGAAGGTCCTTGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030565.5-1554s1c1
Sequence:CCGGCGGGATAAGAAGCTATGGAGACTCGAGTCTCCATAGCTTCTTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030565.5-1850s1c1
Sequence:CCGGCATCATGGATATGACCGTCTTCTCGAGAAGACGGTCATATCCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030565.5-1911s1c1
Sequence:CCGGACCTTTGAGAAGTTCGGGAATCTCGAGATTCCCGAACTTCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030565.5-1980s1c1
Sequence:CCGGTCACACGATGAGCTTTCCATTCTCGAGAATGGAAAGCTCATCGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030565.6-1371s21c1
Sequence:CCGGGAATTACGGGCAGGCGCTATTCTCGAGAATAGCGCCTGCCCGTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030565.6-1206s21c1
Sequence:CCGGCTATCCCAACTGGCTCAAATTCTCGAGAATTTGAGCCAGTTGGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030565.6-2511s21c1
Sequence:CCGGCCCATAGGGAGGGACCTTTAACTCGAGTTAAAGGTCCCTCCCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030565.6-1869s21c1
Sequence:CCGGCATCATGGATATGACCGTCTTCTCGAGAAGACGGTCATATCCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030565.6-1930s21c1
Sequence:CCGGACCTTTGAGAAGTTCGGGAATCTCGAGATTCCCGAACTTCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks