EMAIL THIS PAGE TO A FRIEND

FAM210A

family with sequence similarity 210, member A

66 Gene Product Result for
Synonyms: C18orf19 HsT2329
UniProtKB ID: Q96ND0, D3DUJ4
Gene ID:
Mouse(108654) family with sequence similarity 210, member A
Rat(307343) family with sequence similarity 210, member A
sheep(101110197) family with sequence similarity 210, member A
domestic guinea pig(100730156) family with sequence similarity 210, member A
naked mole-rat(101698114) family with sequence similarity 210, member A
Zebrafish(503762) family with sequence similarity 210, member A
cow(511554) chromosome 24 open reading frame, human C18orf19
domestic cat(101093896) family with sequence similarity 210, member A
dog(476201) family with sequence similarity 210, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153794 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153794 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153794 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152352 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152352 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152352 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150791 MISSION® esiRNA esiRNA human C18orf19 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098801 Rosetta Predictions human pricing
NM_152352 Rosetta Predictions human pricing
NM_001007688 Rosetta Predictions rat pricing
NM_153794 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319909 predicted 1303
2 SASI_Hs02_00319910 predicted 1310
3 SASI_Hs02_00319911 predicted 1276
4 SASI_Hs02_00319912 predicted 991
5 SASI_Hs02_00319913 predicted 1239
6 SASI_Hs02_00319914 predicted 1249
7 SASI_Hs02_00319915 predicted 1241
8 SASI_Hs02_00319916 predicted 833
9 SASI_Hs02_00319917 predicted 793
10 SASI_Hs02_00319918 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028006 predicted 1164
2 SASI_Hs01_00028008 predicted 1166
3 SASI_Hs01_00028009 predicted 1135
4 SASI_Hs01_00028010 predicted 855
5 SASI_Hs01_00028011 predicted 1099
6 SASI_Hs01_00028012 predicted 1112
7 SASI_Hs01_00028013 predicted 1099
8 SASI_Hs01_00028014 predicted 700
9 SASI_Hs01_00028015 predicted 650
10 SASI_Hs02_00365986 predicted 1152
11 SASI_Hs01_00028007 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198834 predicted 1324
2 SASI_Rn02_00198835 predicted 634
3 SASI_Rn01_00071410 predicted 477
4 SASI_Rn02_00198836 predicted 455
5 SASI_Rn01_00071411 predicted 286
6 SASI_Rn02_00198837 predicted 596
7 SASI_Rn02_00198838 predicted 479
8 SASI_Rn01_00071415 predicted 219
9 SASI_Rn01_00071416 predicted 459
10 SASI_Rn02_00198839 predicted 454
11 SASI_Rn01_00071408 predicted 630
12 SASI_Rn01_00071409 predicted 270
13 SASI_Rn01_00071412 predicted 613
14 SASI_Rn01_00071413 predicted 740
15 SASI_Rn01_00071414 predicted 747
16 SASI_Rn01_00071417 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121972 predicted 396
2 SASI_Mm01_00121973 predicted 814
3 SASI_Mm01_00121974 predicted 1506
4 SASI_Mm01_00121975 predicted 659
5 SASI_Mm01_00121976 predicted 316
6 SASI_Mm01_00121977 predicted 635
7 SASI_Mm01_00121978 predicted 1569
8 SASI_Mm01_00121979 predicted 1564
9 SASI_Mm01_00121980 predicted 315
10 SASI_Mm01_00121981 predicted 1557
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153794
VALIDATED
FAM210A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 210, member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153794.2-253s1c1
Sequence:CCGGCCAGGCTCTTTGATCACCATTCTCGAGAATGGTGATCAAAGAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153794.2-2505s1c1
Sequence:CCGGCGGCACACTTTCAAATACAATCTCGAGATTGTATTTGAAAGTGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153794.4-405s21c1
Sequence:CCGGACTTGTGCATAGAGGTGAATACTCGAGTATTCACCTCTATGCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153794.4-451s1c1
Sequence:CCGGCGAAAGCAGTGGCTACATTTACTCGAGTAAATGTAGCCACTGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153794.4-375s21c1
Sequence:CCGGTGATCACCATTGGCGCATAAACTCGAGTTTATGCGCCAATGGTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153794.4-8699s21c1
Sequence:CCGGACGATTACCCGGAGCATATATCTCGAGATATATGCTCCGGGTAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153794.4-450s21c1
Sequence:CCGGTCGAAAGCAGTGGCTACATTTCTCGAGAAATGTAGCCACTGCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153794.4-710s21c1
Sequence:CCGGTAATTCCTGTGCACCTAATAACTCGAGTTATTAGGTGCACAGGAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153794
VALIDATED
FAM210A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 210, member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153794.2-253s1c1
Sequence:CCGGCCAGGCTCTTTGATCACCATTCTCGAGAATGGTGATCAAAGAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153794.2-2505s1c1
Sequence:CCGGCGGCACACTTTCAAATACAATCTCGAGATTGTATTTGAAAGTGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153794.4-405s21c1
Sequence:CCGGACTTGTGCATAGAGGTGAATACTCGAGTATTCACCTCTATGCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153794.4-451s1c1
Sequence:CCGGCGAAAGCAGTGGCTACATTTACTCGAGTAAATGTAGCCACTGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153794.4-375s21c1
Sequence:CCGGTGATCACCATTGGCGCATAAACTCGAGTTTATGCGCCAATGGTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153794.4-8699s21c1
Sequence:CCGGACGATTACCCGGAGCATATATCTCGAGATATATGCTCCGGGTAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153794.4-450s21c1
Sequence:CCGGTCGAAAGCAGTGGCTACATTTCTCGAGAAATGTAGCCACTGCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153794.4-710s21c1
Sequence:CCGGTAATTCCTGTGCACCTAATAACTCGAGTTATTAGGTGCACAGGAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153794
VALIDATED
FAM210A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 210, member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153794.2-253s1c1
Sequence:CCGGCCAGGCTCTTTGATCACCATTCTCGAGAATGGTGATCAAAGAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153794.2-2505s1c1
Sequence:CCGGCGGCACACTTTCAAATACAATCTCGAGATTGTATTTGAAAGTGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153794.4-405s21c1
Sequence:CCGGACTTGTGCATAGAGGTGAATACTCGAGTATTCACCTCTATGCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153794.4-451s1c1
Sequence:CCGGCGAAAGCAGTGGCTACATTTACTCGAGTAAATGTAGCCACTGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153794.4-375s21c1
Sequence:CCGGTGATCACCATTGGCGCATAAACTCGAGTTTATGCGCCAATGGTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153794.4-8699s21c1
Sequence:CCGGACGATTACCCGGAGCATATATCTCGAGATATATGCTCCGGGTAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153794.4-450s21c1
Sequence:CCGGTCGAAAGCAGTGGCTACATTTCTCGAGAAATGTAGCCACTGCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153794.4-710s21c1
Sequence:CCGGTAATTCCTGTGCACCTAATAACTCGAGTTATTAGGTGCACAGGAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152352
VALIDATED
FAM210A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 210, member A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152352.1-1429s1c1
Sequence:CCGGGCAGTATTAAGCAGTGGTTAACTCGAGTTAACCACTGCTTAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152352.1-1439s1c1
Sequence:CCGGGCAGTGGTTAATGTCTTAGAACTCGAGTTCTAAGACATTAACCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_152352.1-1403s1c1
Sequence:CCGGCCCAGTTTAAGAATTTGCCATCTCGAGATGGCAAATTCTTAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152352.1-1248s1c1
Sequence:CCGGCCCTTTGGAAACTATGGGCAACTCGAGTTGCCCATAGTTTCCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152352.1-721s1c1
Sequence:CCGGGCCTGATCCTTTGCAAGACAACTCGAGTTGTCTTGCAAAGGATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152352.1-446s1c1
Sequence:CCGGCCACATAATGCTGGTCTCTTTCTCGAGAAAGAGACCAGCATTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152352.1-653s1c1
Sequence:CCGGCATGTTTCATTCAGGAGGGTTCTCGAGAACCCTCCTGAATGAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152352.1-1025s1c1
Sequence:CCGGGTGAAGTATCTGCGCAGTCATCTCGAGATGACTGCGCAGATACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152352.3-879s21c1
Sequence:CCGGTTGCAACACCTGCTCGGTATACTCGAGTATACCGAGCAGGTGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152352.3-664s21c1
Sequence:CCGGACGATTCAAGAAGACATTTAGCTCGAGCTAAATGTCTTCTTGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152352.3-700s21c1
Sequence:CCGGTCTGATTCCAGTGCATCTAATCTCGAGATTAGATGCACTGGAATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152352.3-3539s21c1
Sequence:CCGGATGTTGAGTTTGGAGTATTAACTCGAGTTAATACTCCAAACTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152352.3-337s21c1
Sequence:CCGGGACATGCTTGGAACCACATAACTCGAGTTATGTGGTTCCAAGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152352
VALIDATED
FAM210A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 210, member A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152352.1-1429s1c1
Sequence:CCGGGCAGTATTAAGCAGTGGTTAACTCGAGTTAACCACTGCTTAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152352.1-1439s1c1
Sequence:CCGGGCAGTGGTTAATGTCTTAGAACTCGAGTTCTAAGACATTAACCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_152352.1-1403s1c1
Sequence:CCGGCCCAGTTTAAGAATTTGCCATCTCGAGATGGCAAATTCTTAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152352.1-1248s1c1
Sequence:CCGGCCCTTTGGAAACTATGGGCAACTCGAGTTGCCCATAGTTTCCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152352.1-721s1c1
Sequence:CCGGGCCTGATCCTTTGCAAGACAACTCGAGTTGTCTTGCAAAGGATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152352.1-446s1c1
Sequence:CCGGCCACATAATGCTGGTCTCTTTCTCGAGAAAGAGACCAGCATTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152352.1-653s1c1
Sequence:CCGGCATGTTTCATTCAGGAGGGTTCTCGAGAACCCTCCTGAATGAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152352.1-1025s1c1
Sequence:CCGGGTGAAGTATCTGCGCAGTCATCTCGAGATGACTGCGCAGATACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152352.3-879s21c1
Sequence:CCGGTTGCAACACCTGCTCGGTATACTCGAGTATACCGAGCAGGTGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152352.3-664s21c1
Sequence:CCGGACGATTCAAGAAGACATTTAGCTCGAGCTAAATGTCTTCTTGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152352.3-700s21c1
Sequence:CCGGTCTGATTCCAGTGCATCTAATCTCGAGATTAGATGCACTGGAATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152352.3-3539s21c1
Sequence:CCGGATGTTGAGTTTGGAGTATTAACTCGAGTTAATACTCCAAACTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152352.3-337s21c1
Sequence:CCGGGACATGCTTGGAACCACATAACTCGAGTTATGTGGTTCCAAGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152352
VALIDATED
FAM210A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 210, member A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152352.1-1429s1c1
Sequence:CCGGGCAGTATTAAGCAGTGGTTAACTCGAGTTAACCACTGCTTAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152352.1-1439s1c1
Sequence:CCGGGCAGTGGTTAATGTCTTAGAACTCGAGTTCTAAGACATTAACCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_152352.1-1403s1c1
Sequence:CCGGCCCAGTTTAAGAATTTGCCATCTCGAGATGGCAAATTCTTAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152352.1-1248s1c1
Sequence:CCGGCCCTTTGGAAACTATGGGCAACTCGAGTTGCCCATAGTTTCCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152352.1-721s1c1
Sequence:CCGGGCCTGATCCTTTGCAAGACAACTCGAGTTGTCTTGCAAAGGATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152352.1-446s1c1
Sequence:CCGGCCACATAATGCTGGTCTCTTTCTCGAGAAAGAGACCAGCATTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152352.1-653s1c1
Sequence:CCGGCATGTTTCATTCAGGAGGGTTCTCGAGAACCCTCCTGAATGAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152352.1-1025s1c1
Sequence:CCGGGTGAAGTATCTGCGCAGTCATCTCGAGATGACTGCGCAGATACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152352.3-879s21c1
Sequence:CCGGTTGCAACACCTGCTCGGTATACTCGAGTATACCGAGCAGGTGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152352.3-664s21c1
Sequence:CCGGACGATTCAAGAAGACATTTAGCTCGAGCTAAATGTCTTCTTGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152352.3-700s21c1
Sequence:CCGGTCTGATTCCAGTGCATCTAATCTCGAGATTAGATGCACTGGAATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152352.3-3539s21c1
Sequence:CCGGATGTTGAGTTTGGAGTATTAACTCGAGTTAATACTCCAAACTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152352.3-337s21c1
Sequence:CCGGGACATGCTTGGAACCACATAACTCGAGTTATGTGGTTCCAAGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks