EMAIL THIS PAGE TO A FRIEND

FAM211A

family with sequence similarity 211, member A

71 Gene Product Result for
Synonyms: C17orf76
UniProtKB ID: Q8NAA5
Gene ID:
Mouse(192976) family with sequence similarity 211, member A
Rat(691777) family with sequence similarity 211, member A
dog(100687774) family with sequence similarity 211, member A
cow(509555) family with sequence similarity 211, member A
domestic cat(101093723) family with sequence similarity 211, member A
sheep(101106699) family with sequence similarity 211, member A
domestic guinea pig(100729794) family with sequence similarity 211, member A
naked mole-rat(101705329) family with sequence similarity 211, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198861 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198861 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198861 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207387 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113567 Rosetta Predictions human pricing
NM_207387 Rosetta Predictions human pricing
XM_001079602 Rosetta Predictions rat pricing
NM_198861 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326091 predicted 1586
2 SASI_Hs02_00326092 predicted 1512
3 SASI_Hs02_00326093 predicted 1199
4 SASI_Hs02_00326094 predicted 1287
5 SASI_Hs02_00326095 predicted 1418
6 SASI_Hs02_00326096 predicted 873
7 SASI_Hs02_00326097 predicted 1537
8 SASI_Hs02_00326098 predicted 979
9 SASI_Hs02_00326099 predicted 1425
10 SASI_Hs02_00326100 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097912 predicted 1298
2 SASI_Hs01_00097911 predicted 760
3 SASI_Hs01_00097913 predicted 861
4 SASI_Hs02_00373989 predicted 1309
5 SASI_Hs01_00097909 predicted 1079
6 SASI_Hs01_00097910 predicted 585
7 SASI_Hs01_00097914 predicted 804
8 SASI_Hs02_00373990 predicted 1155
9 SASI_Hs01_00097915 predicted 577
10 SASI_Hs02_00373991 predicted 1058
11 SASI_Hs01_00097908 predicted 997
12 SASI_Hs01_00097916 predicted 908
13 SASI_Hs01_00097917 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364839 predicted 479
2 SASI_Rn02_00364840 predicted 665
3 SASI_Rn02_00364841 predicted 758
4 SASI_Rn02_00364842 predicted 498
5 SASI_Rn02_00364843 predicted 467
6 SASI_Rn02_00364844 predicted 498
7 SASI_Rn02_00364845 predicted 565
8 SASI_Rn02_00364846 predicted 764
9 SASI_Rn02_00364847 predicted 464
10 SASI_Rn02_00364848 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351180 predicted 1178
2 SASI_Mm01_00063613 predicted 1387
3 SASI_Mm01_00063614 predicted 649
4 SASI_Mm01_00063615 predicted 1460
5 SASI_Mm01_00063616 predicted 1078
6 SASI_Mm01_00063617 predicted 1272
7 SASI_Mm01_00063618 predicted 1136
8 SASI_Mm01_00063620 predicted 920
9 SASI_Mm01_00063621 predicted 1254
10 SASI_Mm01_00063622 predicted 1490
11 SASI_Mm01_00063619 predicted 921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198861
FAM211A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 211, member A
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198861.1-407s1c1
Sequence:CCGGGATGATGTGCTGTACCGCTATCTCGAGATAGCGGTACAGCACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198861.1-824s1c1
Sequence:CCGGCTTACCACACTTGCCCTCAATCTCGAGATTGAGGGCAAGTGTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198861.1-454s1c1
Sequence:CCGGGATCACACACGACCTCATCATCTCGAGATGATGAGGTCGTGTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198861.1-913s1c1
Sequence:CCGGCAATGTCACATGGATTGACCTCTCGAGAGGTCAATCCATGTGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198861.1-1131s1c1
Sequence:CCGGCAGAGTGTGTGATTCAGACATCTCGAGATGTCTGAATCACACACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000455004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198861.1-1260s21c1
Sequence:CCGGGGATGAGATCAGAGTACTAACCTCGAGGTTAGTACTCTGATCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198861
FAM211A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 211, member A
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198861.1-407s1c1
Sequence:CCGGGATGATGTGCTGTACCGCTATCTCGAGATAGCGGTACAGCACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198861.1-824s1c1
Sequence:CCGGCTTACCACACTTGCCCTCAATCTCGAGATTGAGGGCAAGTGTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198861.1-454s1c1
Sequence:CCGGGATCACACACGACCTCATCATCTCGAGATGATGAGGTCGTGTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198861.1-913s1c1
Sequence:CCGGCAATGTCACATGGATTGACCTCTCGAGAGGTCAATCCATGTGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198861.1-1131s1c1
Sequence:CCGGCAGAGTGTGTGATTCAGACATCTCGAGATGTCTGAATCACACACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000455004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198861.1-1260s21c1
Sequence:CCGGGGATGAGATCAGAGTACTAACCTCGAGGTTAGTACTCTGATCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198861
FAM211A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 211, member A
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198861.1-407s1c1
Sequence:CCGGGATGATGTGCTGTACCGCTATCTCGAGATAGCGGTACAGCACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198861.1-824s1c1
Sequence:CCGGCTTACCACACTTGCCCTCAATCTCGAGATTGAGGGCAAGTGTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198861.1-454s1c1
Sequence:CCGGGATCACACACGACCTCATCATCTCGAGATGATGAGGTCGTGTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198861.1-913s1c1
Sequence:CCGGCAATGTCACATGGATTGACCTCTCGAGAGGTCAATCCATGTGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198861.1-1131s1c1
Sequence:CCGGCAGAGTGTGTGATTCAGACATCTCGAGATGTCTGAATCACACACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000455004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198861.1-1260s21c1
Sequence:CCGGGGATGAGATCAGAGTACTAACCTCGAGGTTAGTACTCTGATCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207387
FAM211A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 211, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207387.1-985s1c1
Sequence:CCGGCCCATTATCTGCCATTTGGTTCTCGAGAACCAAATGGCAGATAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207387.1-2121s1c1
Sequence:CCGGGCTGGAACAAAGCTACACCAACTCGAGTTGGTGTAGCTTTGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207387.1-1457s1c1
Sequence:CCGGGCCCATGCATACAGGCATAAACTCGAGTTTATGCCTGTATGCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168439    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207387.1-995s1c1
Sequence:CCGGGCCATTTGGTTCTCAAGTCATCTCGAGATGACTTGAGAACCAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207387.1-980s1c1
Sequence:CCGGCCTATCCCATTATCTGCCATTCTCGAGAATGGCAGATAATGGGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207387
FAM211A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 211, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207387.1-985s1c1
Sequence:CCGGCCCATTATCTGCCATTTGGTTCTCGAGAACCAAATGGCAGATAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207387.1-2121s1c1
Sequence:CCGGGCTGGAACAAAGCTACACCAACTCGAGTTGGTGTAGCTTTGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207387.1-1457s1c1
Sequence:CCGGGCCCATGCATACAGGCATAAACTCGAGTTTATGCCTGTATGCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168439    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207387.1-995s1c1
Sequence:CCGGGCCATTTGGTTCTCAAGTCATCTCGAGATGACTTGAGAACCAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207387.1-980s1c1
Sequence:CCGGCCTATCCCATTATCTGCCATTCTCGAGAATGGCAGATAATGGGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207387
FAM211A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 211, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207387.1-985s1c1
Sequence:CCGGCCCATTATCTGCCATTTGGTTCTCGAGAACCAAATGGCAGATAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207387.1-2121s1c1
Sequence:CCGGGCTGGAACAAAGCTACACCAACTCGAGTTGGTGTAGCTTTGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207387.1-1457s1c1
Sequence:CCGGGCCCATGCATACAGGCATAAACTCGAGTTTATGCCTGTATGCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168439    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207387.1-995s1c1
Sequence:CCGGGCCATTTGGTTCTCAAGTCATCTCGAGATGACTTGAGAACCAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207387.1-980s1c1
Sequence:CCGGCCTATCCCATTATCTGCCATTCTCGAGAATGGCAGATAATGGGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks