EMAIL THIS PAGE TO A FRIEND

FAM211B

family with sequence similarity 211, member B

41 Gene Product Result for
Synonyms: C22orf36
UniProtKB ID: Q2VPJ9, Q8N0S9, Q8N8B1
Gene ID:
Mouse(192734) family with sequence similarity 211, member B
Rat(100365744) family with sequence similarity 211, member B
naked mole-rat(101722505) family with sequence similarity 211, member B
domestic guinea pig(100718438) family with sequence similarity 211, member B
dog(100682757) family with sequence similarity 211, member B
domestic cat(101092055) family with sequence similarity 211, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207644 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_371460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371460 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198860 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198860 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198860 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207644 Rosetta Predictions human pricing
NM_198860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374164 predicted 982
2 SASI_Hs02_00374165 predicted 715
3 SASI_Hs02_00374166 predicted 520
4 SASI_Hs02_00374167 predicted 542
5 SASI_Hs02_00374168 predicted 727
6 SASI_Hs02_00374169 predicted 354
7 SASI_Hs02_00374170 predicted 849
8 SASI_Hs02_00374171 predicted 746
9 SASI_Hs02_00374172 predicted 698
10 SASI_Hs02_00374173 predicted 863
11 SASI_Hs01_00185894 predicted 591
12 SASI_Hs01_00185895 predicted 607
13 SASI_Hs01_00185896 predicted 590
14 SASI_Hs01_00185897 predicted 942
15 SASI_Hs01_00185898 predicted 769
16 SASI_Hs01_00185899 predicted 796
17 SASI_Hs01_00185900 predicted 876
18 SASI_Hs01_00185901 predicted 883
19 SASI_Hs01_00185902 predicted 526
20 SASI_Hs01_00185903 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070823 predicted 1460
2 SASI_Mm01_00070824 predicted 756
3 SASI_Mm01_00070825 predicted 411
4 SASI_Mm01_00070826 predicted 841
5 SASI_Mm01_00070827 predicted 1628
6 SASI_Mm02_00351179 predicted 643
7 SASI_Mm01_00070828 predicted 1107
8 SASI_Mm01_00070829 predicted 1177
9 SASI_Mm01_00070830 predicted 1342
10 SASI_Mm01_00070831 predicted 396
11 SASI_Mm01_00070832 predicted 1365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207644
FAM211B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 211, member B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000140283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207644.1-614s1c1
Sequence:CCGGGAGAGACAATGGAAGAGGGTACTCGAGTACCCTCTTCCATTGTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207644.1-2438s1c1
Sequence:CCGGCATCAAGGACACCACCAAGTTCTCGAGAACTTGGTGGTGTCCTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207644.1-2423s1c1
Sequence:CCGGCAAGCTCACTGATGCCATCAACTCGAGTTGATGGCATCAGTGAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207644.1-591s1c1
Sequence:CCGGGTGAGGTCAAATCATCTTGTACTCGAGTACAAGATGATTTGACCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207644
FAM211B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 211, member B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000140283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207644.1-614s1c1
Sequence:CCGGGAGAGACAATGGAAGAGGGTACTCGAGTACCCTCTTCCATTGTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207644.1-2438s1c1
Sequence:CCGGCATCAAGGACACCACCAAGTTCTCGAGAACTTGGTGGTGTCCTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207644.1-2423s1c1
Sequence:CCGGCAAGCTCACTGATGCCATCAACTCGAGTTGATGGCATCAGTGAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207644.1-591s1c1
Sequence:CCGGGTGAGGTCAAATCATCTTGTACTCGAGTACAAGATGATTTGACCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207644
FAM211B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 211, member B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000140283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207644.1-614s1c1
Sequence:CCGGGAGAGACAATGGAAGAGGGTACTCGAGTACCCTCTTCCATTGTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207644.1-2438s1c1
Sequence:CCGGCATCAAGGACACCACCAAGTTCTCGAGAACTTGGTGGTGTCCTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207644.1-2423s1c1
Sequence:CCGGCAAGCTCACTGATGCCATCAACTCGAGTTGATGGCATCAGTGAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207644.1-591s1c1
Sequence:CCGGGTGAGGTCAAATCATCTTGTACTCGAGTACAAGATGATTTGACCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371460
FAM211B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 211, member B
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000122379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371460.2-711s1c1
Sequence:CCGGCCGCAAGCTCACTGATGCCATCTCGAGATGGCATCAGTGAGCTTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371460
FAM211B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 211, member B
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000122379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371460.2-711s1c1
Sequence:CCGGCCGCAAGCTCACTGATGCCATCTCGAGATGGCATCAGTGAGCTTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371460
FAM211B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 211, member B
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000122379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371460.2-711s1c1
Sequence:CCGGCCGCAAGCTCACTGATGCCATCTCGAGATGGCATCAGTGAGCTTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198860
FAM211B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 211, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198860.1-645s1c1
Sequence:CCGGGACTGTGGATCTTTCTGGCATCTCGAGATGCCAGAAAGATCCACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198860.1-426s1c1
Sequence:CCGGGACTTTCCTTAACTTGGTGGACTCGAGTCCACCAAGTTAAGGAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198860.1-417s1c1
Sequence:CCGGCAGGAATGTGACTTTCCTTAACTCGAGTTAAGGAAAGTCACATTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198860.1-414s1c1
Sequence:CCGGCCACAGGAATGTGACTTTCCTCTCGAGAGGAAAGTCACATTCCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198860.1-420s1c1
Sequence:CCGGGAATGTGACTTTCCTTAACTTCTCGAGAAGTTAAGGAAAGTCACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198860
FAM211B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 211, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198860.1-645s1c1
Sequence:CCGGGACTGTGGATCTTTCTGGCATCTCGAGATGCCAGAAAGATCCACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198860.1-426s1c1
Sequence:CCGGGACTTTCCTTAACTTGGTGGACTCGAGTCCACCAAGTTAAGGAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198860.1-417s1c1
Sequence:CCGGCAGGAATGTGACTTTCCTTAACTCGAGTTAAGGAAAGTCACATTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198860.1-414s1c1
Sequence:CCGGCCACAGGAATGTGACTTTCCTCTCGAGAGGAAAGTCACATTCCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198860.1-420s1c1
Sequence:CCGGGAATGTGACTTTCCTTAACTTCTCGAGAAGTTAAGGAAAGTCACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198860
FAM211B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 211, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198860.1-645s1c1
Sequence:CCGGGACTGTGGATCTTTCTGGCATCTCGAGATGCCAGAAAGATCCACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198860.1-426s1c1
Sequence:CCGGGACTTTCCTTAACTTGGTGGACTCGAGTCCACCAAGTTAAGGAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198860.1-417s1c1
Sequence:CCGGCAGGAATGTGACTTTCCTTAACTCGAGTTAAGGAAAGTCACATTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198860.1-414s1c1
Sequence:CCGGCCACAGGAATGTGACTTTCCTCTCGAGAGGAAAGTCACATTCCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198860.1-420s1c1
Sequence:CCGGGAATGTGACTTTCCTTAACTTCTCGAGAAGTTAAGGAAAGTCACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)